Description :
From Genome Similarity Track
Location :
Scaffold_2046:1521- 4888
Transcript NameFunction/comments
Phypl_g14596reverse transcriptase
Phypl_g14597hypothetical protein

Sequence
3367 bases(100 bases per row)
GCTATGACCTGGAACGGGTAGGTTGCTTGGATGTTCCCTTGCGACTCTCCCTGGATCGTGGGCCGTCCTTTCCGGGTTTCGCAATCGACACATTCTCCTA
CATGGCGCTGCACACTCCGATCGAGACCCCGCGAGTGGAAGTGACCTCTGATCCGTTGACATGTACGGCCGATTCCCTGATGTCCACCCTCCAGGCTCGC
ATGGTAATGGTGCAAGATATTCTGATGCAGGGATTCCGGCGCCACCAGTCTCATGAGGCCATCTCGATCAGCCTCCGCACGTTTCGTAGGAGGATAGTAG
AAAAGCAGATCGTGAAGATCCACCTCACAATCCAAAGCGATGTTACCGCAGTATCTAGCCTCCTCTTGAGTCAAATCGTCCACCTGTCCAGCCAGATACT
TCCTCAACCTCGAGATCCACGCCCCCTCGTCTTGTGCTCGCTTAATCCGCTCGATCCGGAGGTCCCGCACGAGCTCCTCTTGTAATACCGTGGGTCTCGA
TCTGGATCTGGGGTTGGTTCTAGTTCGTACAGGCGAGACTCGCACTACCTGATCTTCAGTTTTCGCCACTAGAACTTCGTCTAATCGGTTCAACGTAATC
AGATCTTTCTTCTCGGACTCGTCCTCAACTTCGATCCCGTACTGACGCTGGAGGGCTGCTCCAGCCAGGCTATCTGCACTACCGTTCCAATCACGTTTCA
CATGGACCAACTCATGATCTAGCCATGCCTGTAAGCGATCTAGCGCCCTCTGCCTCAGGGGCGTGAGACCCGGTGCTTTGCAATTGATCTCGCCCCTCAT
CTGGCGAACCACCAGGTTTGAGTCGCCATAGATCACTACGCGTCTCCAATCTACCACTTCAAGAAGATCTAGGCATAGCAGGAGCCCATGATAATCTGCC
TCGTTGCCGTCAGACTGTTGGCATAGCATGATCTGGCCTTCAGCACTGCCATTTCCACATGATCGCACTGTAAACGCCCCCTCCTCTTTTAACTCGAACA
AATCCATCGAAACTCAGCACGACCAGTTCCTCGTCATCGGGATCGGGGCTTGGATCTTGCGTCttgtctccttcctggggGAGATCGCGATCAGGGTCTT
GTCGACCTCAGATCTGGGCGTGATGCTGGCAGTAAGCGCTCCCAGGATCGAGTCTTCTCCTATTGAGCATCGTACGATCTCGAGCGTCCAAGGCGACAAC
AACGCTGCCCATTGACCCAACCGGCTCTGGAGGCCAGCGGATCTGAACAGCCATGCTAGTGTTGAATGCCGAGTTAGGATCCGGACGGGTCTACCGACCA
ACAGATTATAAGATTATAGTTGAGATCCAGGACCCGCAATAGCGCCAATacctccttctcgaccaCTCCATAGTTCAACTCGTTCGCTTTGAGCGTACGG
CTCACGAAAGTAATCGGATAGTAGACCCTGTCGTACTCCTGCATAAGGGCTGCTGATATAGCCCAATCGCTGGCATATACCACGACTACAGCCTGGCGAT
CCGGGTCAAAATGCCGCAAcacgggcgtcgtcgcgatcttctccttcaacCTCTTGAACGCCCGGTGCGCATGGACCCACCGTCTGTTCACATCGGAGGA
GTCTTGTGCCACCTGATCTGCTGCCACCACACCTCGAGCTTCCAGATCGAAATCTGTGGTGTCCCGATCGGGGGTCTCCGCTTCAAGGAGCATCGTGATC
TGGTCACTGGCCTGCTTCTTAGTCATGGCGGCGAAATCTACCTCTCGCAGCTCGTACATCATTGAAGTGTAGATCGCATAATCTTCGATAAAACGGCTAT
AGTAGTTTAGGCTGCCTTGGAAGGATTTGCATAGATCGTAGTGACGCCGGAAATGGCAGATCAGTCAGCGCGGCCAGATCCTTAGGCTTCGCCTCCAATC
CATCCTTTGACACGCGATGCCCAAGGTACTCCACCTTTCTCATACCGTAGAAGCTTTTCGCCACGCTGATCGACATGTTCCACTTATCGCACGCCTCCAG
TAAGGCGTCCACCCGATCGCACAACTGGTCCATGATCTAGCTGGTACCAGAATGTCGTCGATATAGGATCTGCGTCCTAGCACCGACGATTTACCCGGAT
CTTCAGGCTCATCTGCTTCAAACAGATCCGCTAGTCCTCCATCAGCTCCAGATCGCGGGATATTGATATGATCTGTGAGGGTGCTGAGAGCTACTAACCT
GCTAATCTTAGGGGTTATGGCTGGACAAGAGAGCACACGCGAAGGGGGACGTGGTCGTCGAGGACGCGGTCAAGCGTCACGACAATCGCGTCAAGTTCGA
GGGATGCCGCCGGAAGAGCAGAAGTCTCTGGAAGAagtggagaaggaagatcAGATGGCCAACGCTGCGAAGCGTAAGGCATCCCAAGAGGAGAAAGAGT
CGGCGGATATTCAAGATCAGCCGGACTCGAAGCCCGCAGTTCAGGATGCGCACCAAGTTTCCTtggatgaaggcgacgaggacgactcgAAGGCGAGATC
TCTGAGCGGCTCCCCGAGGGGCTCCAGCTCGGGTTAGAGCGTGGAGTTCTTGGGAACGTCCAACCTGGATGTGCCCGTTAAGGCGTATGTGGGAGATGCG
GTCAAGGTTGAGTCCTCGGCTGAGGGAGGTCCTTCGGGACCACCTAGGACGAGTCAAGATGTGGTGATCGTGGATGACGACTCCGAAGTTGAAGAGAAGC
GTCCACCTGAAGATGACGTTCCGGACGAAACACCCACGATCAAGGAAGAAGGCCCGTTGTCAACGGTGAAGGAAGAGGCGGCTCCGGAGAAGTCGAAAGA
GTCCCTTCTCCCAAAGCCAGAACCATCGCCTGGCCAACAAGCACCGCCACCTCGCGAGTTAACTTCGCTCGGGACCCCGCCATCACCGGCATCCCGGATG
GAGATTGACTTGGTTTCGGAGGTGGAGTCCGATGAACGAGGTGACTGGATGAGCGTGGAACAGGCGCGAGCGTACATGGGTGATCAAGCTCACCGCTGGG
AGCATGTGCTTTTCGAGTTCATCGCCTCCCAGACGATCCACTACGAGTGGCCACATCCTAACCCGGATTTTCATCCGTGGTGGTCAGCGATGAAGGCAAC
GTCCGAATACATTGCAGCGCGGATGTCGATGGCCACTCAGAATGAAGCGTGGATCTCCAAGTGGGCTAGGCCCCAATGAGGCCCAAGATGGCACCGCGAC
TGTGATTCCCCTGAGCTCGCTGACGGCCCGTGAATGCGTTGCGTTGCTGCAAACGTTGTTCTTCGAGGCGGGATTCAGGTTTCGCAACCTGATCCCGAAT
GGTTCCAGACACGGGTATCTCAAGTGGATCCGAGAATGGTGTGCGGAGTGGCTGATGATCTTCAACA