Description :
From Genome Similarity Track
Location :
Scaffold_273:1521- 2727
Sequence
1206 bases(100 bases per row)
TTACCTCCAGATAGGGTTGTCCGTAATAAAATTGACTTGGCCCCTAGGACCAAATATTATGTCACACGTTAGTCGCCCTTCCAAAAGAACAGTGTGATGT
CATCGATGACTTCTTCCATGCCAAGCACGAGGCAGGATTAGTACGTGAGAGTAAGTTCCACACTTGACACCGACCTTTTGTGTCCATATTTTAAGATGTA
GTTCTTTATAACAACATGGTAGGCTGGCCATGTACAGTGCATTCAAATTAGTCGGTGGAAATTACCAATTTCTCATGCGAGCGAGTGGAATTTATCTGAC
AGCATTGAGAACTCCGAGTGCTATGCCATGGGAATGGCTGGGTATGTCTTAAGGGCTTTCCAACGCTCCAGCTAGTTTAATCGTCTGTTGACGCAACGTT
TTGTCTTTAACGGGTCATGCTCAGACATGCTTTGATGATGTTTTCGTCCATAGTAGTTCCGAACAGGGGCGTCAAATGTTGACAATTACCATAGACCAGT
TTCGAGCAGTACTTGATTGCTTACGCACGAATAAGATGTATGACAATGCATCTAAATGTATATTCGGTGCCATTTTAAAAAGTTTCATTGAGAAGGTAGA
CCAAGAGTGGATCCTGCTCAGGTCATAGCTATAGTTGACGGGCCGATTTGTAAGAATTAAAATGACTTAATTAAGTAGCTTGGCCTTACAATTTACTGAA
ACAAATATAGCAAAAATTGGGCTCATATGGCTAGTCCATTTATAAAACTCTCTAAGAAAGAAACGGAGTGGTGCTGATATACCATCCATGCAAAGTAATG
GAATGTAACCTCCATGCTCCTATTTTATGTCACCTGGTTACCCTTTTAGTGTCGTCAGTGACTCAATTGATTTTGACAGAGGCAGCGCCCTGTTGCAAAC
ATATGCTGTAGGACCTGAGCTAATCAGTGCTTTTAAAAATATCTTCATCTCAAGCAGCTTAAATAACTATCCATTTCATGACAAATAGTTACTTGCCATA
AAGAATGCACTAATCAAAGTTAGACCTCATCTGCTTGGCTCCAAGCCATTCGACTATACGGGTCATGCATCGTTACGCACGGCGACATAGTCGCCTCACC
TCCTTCATATATTGGATCGTGGGCTTTCATGATTTTTGGCATATCACTTGGAGAAGAGGTATAAGCAGGGAAAACGCATTTTTTAGTGGATGCGCTGTCC
TGCCGA