Description :
From Genome Similarity Track
Location :
Scaffold_9:152087- 155647
Transcript NameFunction/comments
Physo_354165predicted protein putative

Sequence
3560 bases(100 bases per row)
CTGCGGCAAGTAAGGAGCCAAAAGGTTCATGCTCTCACGAACGTGGTCCTTGTGGACGACGCCGAGACTAGCAGTAGCCGTGAATTTAGCCCAGTTGGTG
GCCTTGCCCAGCCACTCCAGGTTCTCGCGCAAAAACGTATCCGACGTAGTGCCGCAGTTCATGTAGGCGTGCGCAATCACAGCAGCGTGGTGCAGCACCG
AGTTGCGGTTTTCCACCGCGGTCTTAATAGTCTTCATAACAAGCGGGTCCGAGTCACTGTGGCTGTGCAGGAAGTCTAGTTTCAGGTCCACAAGGAATTC
ACCCGACAAGATCTGCTTCAACTTGGCGAGCTTGTCCCAGTAATCAGCACAAGCTCCAGCAGGAGCTTGCGGGGGCGTGGCAGGCACATCGGCGGGTGCG
GGGGCTTCCGTCTTACCCTCTTCAGCTGTGGTGGTCGTGTCTACCGCTGGTTCGGCAGCGGGGGCTGGCGGACTCGGGAGCGAGTGGTAGACATTCATGA
GGAACTTTTGGTTCTCGTTCTCGTTGAGGTCGAACGCCACCTGGAACGCGACGAGGCAGTCGCTGCCGCGCACGAGCTGGTCCAGAATCTTGGCGACTTC
CACGTGGTTGTCCAGCATCTGCAAAACTTGACACACGCTGGCGTGCTCCTGGGTCGGGCGCGAGCGGTAGACTTCCAGCATGACCTCGAACACCTTGAGG
CGGAAGTGGCGGTTGCTCACCACCGTCTTGCAGATCTCAAAGCAGTACGCCAGAGCCGCCGACACGTCCGTGGAGCGAGCGAGACACTCCTTCACCTGGT
CCAGTCGTCGGGCCTCCAGAGCAATGCCCATGGCCTGGCGGAACTCGCCGGCCGCGTAGCAGCGCTCGAACATGCGCTCCACCACCTGCGTGAGTCGCGG
GTCCAGCGCCTTCTCGGCCTCCGGGTCCTCCTTGGCACGCACCGCCACGTAGTTGTCGATGCACGTGGCGATGATCGTGTCTGTGTACTGCGAGCGCGTG
TTCAGGTCGAAGTACTTGCCGGCGCCCAGCGCCAGACGCAGAGCGTCCTCGTACTCCTCCAGGTGGAAGAAGCACTTGGAGGCCACGTAGGCCGCCAGCT
CGCGGTCCGGGAAGCTCTTCTCCTCGGAAAGCTCCTCGATCAGCGGGATGGCGTCCGCGATCTCGGCCCAGTAGTGGTCCACCACCAGGTTCAGCTTCTG
CAGGGCATGGGCCTGGGTGTTGACACGCAATTACGACGTTAGTAGAGGTCCCCCAGCGATAAAACGAAGTGCATCCGATGCGCCGCGCTGTGCCTCACCT
TGAGCGCGTTGTCGTCTTCTTCCAGGAGCGCGAGGACGCCCGCGGCTGAGCAGATACAGACAAAAGATCCACCCGGTGGAAGTTAGATTTGCGGCGCCTG
TAGACGACGGCTGGAGCCCGTCGTCGCGGATTATTAAAGGATAGATACAGTGATAGGAGGGAGACGCAGGGGGAGACGCCTCCGACGGCCTTGAGAGACG
GTAAACGTACCGGAGTTGCCGTGAGCGACGGTCATGCTGTCTCTTCCTGTTGTTGCTTCACGCTCCAGAAAGAAATCTTCTCCTCACTAGAAATCTTCCC
TTCATGCCTTAAGTACGAATGTACTTAGCCGGAGCTGAACAATACGTCTACTCCGGTGTTTATTACAAACATAGCTGCATCGTTTCCCTTGTCATTTGGA
TTGTCTTACCAAAAATTACACAAACTATAGCCAGGTTGAAGTGACAAAAGATACTTTTGCGTCTGTTGCCAGTCATTCAAGCAGCGCGACAAGACCAAAA
CTACACGAAGGCCATGGTATGCATGCTACCTTACATCTTTACGACGTGGATGCGGTGGAGGCTAGTTTTCCTTTTGCACTGGTTCAAGCAAGACGCAGCG
AGCTAGCCTTGCTGCTCCAACAATGAACTAACGTCTTCTGCACGTGTGGTATCACTCACATATTGCACCTTACTCGCGGTATCTCTGTTATAAATCTGCT
GACAGTTTTCTTGCCGCGGTGTCGTCTATATGAGACGCTATCGGATGCTACGTTCTCGTATCGGACAACATCATGAAGTTCCTAGTCGTTGCAACGAACC
ACATACAATTTCCGAAGGTCATCGTGCCGCACGATTCGTGTGGCGAATCGAAGCTGCTCCACAACGCTATGATTGTGTCTTTTCAAAAGGCGCGCCAAAA
TAGACACCAAACTTGTCCTGCGGGTTATCCGCAAAGGATCCCAAATATCTCGAACAACTTTCTGATCTCTGTATTCAGGTTAGCTGGCCGCAGCCTGGGA
GCTTAGCGACTTCTTCCCACACTTTAGGGCTAACAACGTCAATCCCAGAGCCTCTAGCAATGTCAACCCCATTCCAGTCCTGTGGCGGATCACCAGTACA
TCCCGATTCCACAGCACCAAATCGCATTAAGCGCGAAACGTGTAAGGCTAACTTCACCACTCCATCTCTTCCGAGAGACTCGACCCACCCTCGTGGCACT
TGAAAGGAAACAATGTGTTCAAACAGGGCCCAGTGTGAGCAGATTATCGCAACTGCTGACCGTTGGTTGTCACTTTGCCAATTGGGTGGCAAAAACTTAC
ACATCGTGCTGCTCCAGGTGGATGCTTGAAATTGTGAGTTTCCTCCCGCAAGCACCTTTGCTTGAGCACGATTGAGAGCCGTTCGCACTGCCAGCGAAGC
GCCTGTCGGCGTGTGGCGTGTGAGCATTCGCAGAGATTGGTTGGGCTGGTCCAATTTACTAAATTGAATTTAGTATGATCGGCAGTGCCGTCGGATCTTT
GGGCACTAGTTGCGCCTGCATCGACCAGCGGACGAGCGAGCAAGCAAGCAAGTAAAGCCTTGCTACAATCGGCAAACGTCCCGAGCTGTCGCCCTCGCAT
TGGTGATTTCTGTGGGTCTACGACAGACCAACACACTCAAAACCGGGGCGACACCGAAAGAAACGCTGACAGTCAAGCCATACAAAAACCAGACTATTCT
CTTTGAAAATGGATAGGACCTCCAAACTTTGGATAGGTAACAGCGCAAGCGCCAACCAAAACCATCAAGGAGGTTCATGTTTCAGAGGGTCAACTTGCGG
CACCGCACCCGTGTGCAATGGTCCTTCGTAAAGTTTACATTGCTCCTCCGGAACGACAGGTGGTACTAGTGCTAACCGATGTGCCGTGTACACGTTAAAT
CGGCGATAGAGTGAGGGATAAACTCGACAAGCACCAGAAGTGCAGCACAAGTGAAGCAAGTATCATAAGCTTATTGCATTGCGATCTTCCGAACAAGTCC
ATGCAGATCAAAGTGCAACTTTGCGCCGTCGCCCGATCACCACGGGACAAGTTCAATCGGAAGAATGGCACCACGTTCTTTGACAATGCTAACCTACACG
GGCGGCGAAGTGCGGACAAACAGTGGAGATGACCGGGGTTTGATTTACTTACATAAACTTGCACGACTTTTTGGCTATGCTCAGGTTCGGGACTTCCATC
AACAGTCGGAGATGGTGCTATCCATTGGATGGCTAATTGCAGTGCCGTGGCCGACCACGA