Description :
From Genome Similarity Track
Location :
contig_5:152075- 153354
Transcript NameFunction/comments
g1639.t1hypothetical protein

Sequence
1279 bases(100 bases per row)
TATCAGCACCTCCACTTCGAATCTGCATGTTTCGCTCCACGGTGGTGTCGCCTTGTTTTCACACCGATTCTGCCTGGAGTACGCGGCTCGCCAAACATCG
TCCAGTGTTGTTGATCCTCTCCCTCAACCCACAGAAGGTCATAGTCCATTGAATCCTGGGCTGTGATTGCTGCAAGTAGTGAGGTCAAACCACAGAAACC
GCTCAGTATCGTCGATGCACTCTCAAAAATGGACCAGAATGGTTTGAAAGACGATGCGCTGGCAACTCGACTTCGAGTAAGGAGACAGATTTACTTGCGT
TGGAATCCTCTTCATCTTCGTCTTCGCTATCCAAGCCCAGCCCAGCTGATATCACCTGCTGCAAAGTTGCAAAGAGTGTATCGCACTCGCCGAACGTTTT
GCGTGGTTTGTGTGGAGACAATTCCCGCTTTGCATTATCTTCGCGAGCATCGACATCACTCTCCAATTCATCGGAGGTATCTGATACGCTGTCTTCTTCG
GAGATATTGGTCGAGGATCCAGCTGAATAAATGCCTCTGTCCACAGCAATGAACCCTGGAGATACCGACGCGACCCCACCATTACGGCGAAGCTGAACGC
TGTTACCTCTTGGCTCAGGCTGGTCGCTATGCTCCTCCGAATCACTTTTGCTGTCTCTTCTGTTGGACACTCGTATTTGGACTACTCTTTTCTTCTCCCC
TTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGCTTCGTCCACGCGGCTCCTT
TTCCTCCGCATTTCCTCCGGGGAAATAGTCTTGGACGTGGCGACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGATTTGACGCTCGAGTTCCCCC
CCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGCCCTCTTGTTGATCACGTGG
AGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAGCTCCCTCACACCCACGTCT
GGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCCGCTGTAGCGGGCCACACAG
CCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCAT