Description :
From Genome Similarity Track
Location :
Scaffold_67:152048- 153854
Transcript NameFunction/comments
Aphas_H257_14596unnamed protein product
Aphas_H257_14597Hypothetical protein

Sequence
1806 bases(100 bases per row)
CAAGATCATGTCTGGCCGCGTGGAGCGGTCCTTTATTGAGGTTCCACGCGCGCCCGATGCTTACCGCCCTCCTACAGAACGGATCCAAGATTGGCACGAG
ATTAACACAACGTACAGAGCGCCCACGGAACGAAAGGCGCAGGCGGGGCGATGCATGGATTGCGGTACCCCATTTTGCCAAAGTCGCCATTTGTCCGGGT
GTCCCGTTGCCAATCTGATCCCGGAATGGAACGCACTGGTGTACCGAGACGAATGGCGGGAAGCGTACCTTCGCTTGAGTGCAACCAACAACTTTCCAGA
ATTCACTGGCCGCGTGTGCCCTGCTCCGTGCGAAGGTGCATGCGTGGCCGGGCTCGTGGAACAACCGGTGACAATCAAGAACATCGAATATGCCATCGTC
GACCGTGCTTGGGATGAGGGATGGGTCACCCCGCGCCTTCCCGTACAACGTACGGGTTTGAATGTGGCCGTGGTGGGATCTGGCCCCGCAGGGTTGGCGG
CCGCGGACGAACTGAATCAAATGGGCCATACCGTGACCGTATTCGAGCGCGAAGACCGCATCGGTGGCCTCTTGATGTACGGCATCCCTAACATGAAGGT
ACTACTCGTTTCGCTCATCCAGATGGTCTTCTCAATGGCACGAACCTAGTTGGAGAAGTCAACCGTGGATCGTCGCGTCCAACTACTTCATGACGAAGGC
ATCACGTTCCGTACGAACGTGGATGTTGGGTCGAACGTTCGCGATGTCCTCGCCGATGTACGATCCTTCCTTCTGCTCAAACTCCAACATGATCACGATT
TGTAGATGGATGCTGTCGTCTTGTGTACCGGCTCGTCCATCCCGCGCTTTGCCGATGTTCCTGGGAAGGACCTCTCGGGGGTATGTACCTCGTACCTATG
TATGAACATTCCTACATTGCTCATCGAGGTATCATGATGTAGGTGCATTTCGCAATGGAATTCCTGACGAGCAATCAGAAACGACTTCTCGCGAGTAAGG
AGGGGACGCTCAAGAGTCGATGGAACAAGGATTGGATCAATGCCGAAGGCAAGGATGTGGTGGTTATTGGCGGCGGAGACACTGGCACAGATTGCAGTAT
GTCCATCATGAGTTGAGATATTTCTGCATGTTGATTGTTATGTGTATGTGTAGTCGCAACGGCGCTGCGCCATCGATGCCGTTCCGTGGTGAATCTGGAA
CACAATACGGCGCCACCCGAGGCCCGAAGTCCCGCGAATCCGTGGCCGCAATACCCCAAGGTGTACGGTGTAGATTATGGACACGCTGAAGTGCGCGCTG
TGTTTGGCGAAGACCCGCGGCAATATGAGCGCTTGACTCTTCGCTTTGAAGGCGACGACGCAGGGCGCCTGACCCATGTTGTACGTGGCATGTGTGCTTC
ATGCCATCCCATGTGCATGTGTCCTGATGAGGGCGGCGAATAGGTGACAGCGCGCTCGCAAACACTGGAGGATGGAACCAAGGGACCAATTCCAGGCACG
GAAGAAACATTCCCGTGCGACTTGGCCATCCTCGCGATGGGATTTTTGCACCCTGATCAAGCTCTGCCTCAGTCGTTGCAGCTGCAGACAGACACGCGCA
AGAACATTTGGACGGACAACTACGCCACGTCGATGCCAGGTACTTGTCGAGATCGTTTTCGCTGTCCTGGTTCTAATTTCCTGTTATTTTGAAGGAGTGT
TTGCGGCGGGTGATTGTCGCCGTGGCCAGTCCCTTGTGGTGTGGGCGATTCACGAAGGTCGAGACGTGGCCCAGAAAGTGCAGCAGTACTTTGTGAGCGA
AGGCCT