Description :
From Genome Similarity Track
Location :
Scaffold_759:15201- 17808
Transcript NameFunction/comments
Phyta_totarag10570hypothetical protein

Sequence
2607 bases(100 bases per row)
AGAGAAAGCGAACTCCCGTCGTCAAAAGGTCGATTTCGACGTACCACCATCTTTAAAGCGCACCGGTGTCACTTCAGACGATTTATCGAGTTTTATCATG
CATCAAGAGATCGACTACCCCGATGGAGGTGAGACCTCATCCACTCGTATTTACAGTGCCCAGACAATCCAACTAACCCAATTTATGTTTTGGAGTAGGC
TCAAAAGCAAAGGATAGCaaacatgcagcagcagtcagaAAAGCTGCAAACACACTTGTTCACCTAAAGCCTCTCGATGGACCTCATCATCTCAGCCACC
CTCCAGGTGCAGACGCATTGCCAGCTACCATCACCCATCCAGCCGAATATGAACCAGCAGTACCGCTCACACAACCACCAGCACTCCCCAGTGTACCAAG
CCCAATGTACCCTCCCACTCAGTTTGTATTACCTGGTTACCCCCAGAGCTATCCCGTGACGACCGCCCCCATCGCTTCTTACCCACTCTTCTCACCGCCA
ATTATGCCGGTCAACCCGTACGGAATCGGATTTCCTACGCCATATCTGCCAGGTTGCCCATATCCAACTGCACCTCCGTGGCTTTCATCGGGTGTTTCAT
ACTCGTATCAGATCGGGAATGTTCCTCCACCCGAGCAATTACCAAAGCCTGCGCTACATCAACAAGAGGAAGATATTCGACGGTTGGAGCGAGAGCTAGA
AATGCAGCGTATCGCCAatgagcagcaagctgaagcgAAGGAGTTCGCTCGACTCCAGAGCCGTCTTCAGGAACTACAAGTACGTGATTGCCACAAAACA
CTTACTCTTTGCTTTGTTGAATACTGATCGATGTCAAGTAGACCAAGATTTCGACTCTGACAGTCGTAGATAATTCTTCTGTAACTTCGATCGATGACGA
TGCGGCTGATGACAAGGATGACTCAACTCTCAAAAGCCTGAAGGTACTGTTGTATCTTGCAGTCTTTCTagctggagctgccacgCGTGACGCGCATTGT
TTTGAGTGCAGAGACAACACCTCGAGAGTTTGGCCAAAGTCCGAAACGAACGGGACCTacttgaagagcaagaaaagGTGGATTGAGTTTGAAAATGGGT
TCAATCTCACAGTGCAATCTAACGTAACGTGTGCTAGCTCGAAGAGCTAAAGGAACGCCTCCAGCGTCAAAGGGAGGAGAAAAAGCGTGAATTTGATCAT
GAGGATTGGGTTGCCAAACAGAAACGAGAACTGGTCGCCCTTCGAATTCAGCGTGCAATTCAGCACAACGATGTAAAAATGGATGCGCTGCATACCGATT
TTCAGGAGGGGACCACTGGTCCGTACAATCCACAGAAGGGTTTTGCATTGTTTTGGGACTTTGCTCTGGGTATACCCGCTACAGTAAATGATTTACAGGT
ATGGTTGATTCCTTTCAAATTTACGACCCGATCTGCTGACATTCTTTCACTTTTCAGATTACCTACGCTGTGTTTGAAGGGGAAAGCATTCGTACACCGT
TCAAAGTTGTCTCCGCTAAAAAGACTAAGGCGATTGGTCCGCAACAAAAGCTGTGCTTGTTTCTCTCTTCTCGCCATATAAAAAAGCTGTCTGCGGCACC
AGACCTACGTGTTATCATGGAGGTGCGAGCACAACGGCATGAACAATTTCATTTAGTCAACGGAACTTAACTTTCTTTGCGTTGTGTTGAAGGTGGCATC
GATGGGTCAAAATGGTGCAGGTGGTCCGCGTGTTCCAACGAGTTTAGGCTGGACAGCGGCTGACGTCTTTAGACTggcaagtgaagaagattTGGCCTTA
GCGTGTGGATTGTTAAAGCTTCCTGTGAAGCAGTCGTCAATGCCAGACCCGTCGAAAACTCTCGTCGTTCCACCAGCAATTGGCGACTGCGGCGACATGA
GGATACACATCCGACTAGTGCATGGTAAAGACGTAGAAGAAGCTTCCCGGATGCTCGTGGACCCAGAACTGCATGCAGGTGCATACGCGATCGCAGATTC
TAGTCAAGATGCCATGTAGCAGCAATATCTGACGTATATAACCATGTGTGCTTGCTTACCCGCAGCACGCTATCAACTAGCAGACACCGGGAAGGTACTT
CCTAGACCGCAATCAAAGGATGTAATGGTCCGTCGGCCTTCTAGACAAGGTAGAAGGACCCCGAGTGAGAAGTCTACCCCCGCAGAGCCTCTCGATGACC
AAAGGGGAATTTCTCCTGATGCACCGATGGAACACTTTTCCGAACTAAcatcgtcaacttcttctcaAAAGCAAGATTTCCTTGACATCGACCGCTTGCG
CTTGCTTTCGTCTACACCCTCGCGGCCACCTAGTACGCGTCCACGCTCGAACATCCCACCTACAGGCGACAGATCTCGGTTAGCTCCTTTTCGTGAAGAC
AGTGGTGCAGAGGCAGACGAACCCTGGATCTGCGTTGACAAGACGTTCGAGCTACAAAGGCGTCTGCTTGGTGGAAATTCCTTCCAACCTGGTGATGGCT
TCAATGTGTACATCGACGGCGGTCGTGGGTTTCCAGATAGTGTCACCATTTCCAAGCTAACAATCGCAGCACTTCAGGTAGACCGGATCCAAGTTGTAGC
TGGAAAC