Description :
From Genome Similarity Track
Location :
Scaffold_9:152007- 153289
Transcript NameFunction/comments
Phyci_212373hypothetical protein
Phyci_212260conserved hypothetical protein

Sequence
1282 bases(100 bases per row)
AGTACAACGCTATGAATCAGAAGCAGAAGAAGGCGCGTCAATTGATGGACAAGTTACACACGTTCACAATACGTACAGGTATACATACGTACCGTAGACC
ACGGGGAGCACAGCGTCCGTATACTCAACGAGCACGAGGTACTCCGTAATGTATAACACTCGGGTAGTCGTACTTATGAACTGCACGCTCCTGCCGCGAG
AAAATCGCTTCAAGCCGCTGGAAAGACCTGTTGGATTTCAATTCAGCTGCCGGTCCTGAACTGATGGTGCCCGCTTTTGATATGCGTTGCTGTAGAAGAC
TTGTCGGGAATATTTTGCTAACTTGAGGTATCATCCGCTTTGAAGCACCCCGCCGTTTTGACTCCACACGGATGGCGGACAATATTTCAGTCGGTCTTGC
GCTATATGAGGAGTGCTCACATTGTCGCTTTGGAGGTAAAATTGCCTTCAGAACGTGGGTATCTTGCTTCTTGCCATGCATTCGAGCCCGTAGTCGGTCA
CTCGATTCGGCACGATCTTCTATTGCCAACAACCGCGATGCAATCTCCACAAAATTTTCCGTGGCAAGGGGGTGATGAGGTGGGATTCTGGCCATCAAGT
CCTCCACCTTACTGACCACCCCAAGAGTACCTCGCATTGAAAACCGTGGCGCACGTCAATTAGCGTGACTGTCATGGTTGTTCCTAGTGACGTGGACTTT
TGTATAGCAGATGATACATAGAGTGCGTTGAACACTTCCACGTTAAAGATAACAACTTCGGGTTTGATATCATTTTGGTGCGAAAGGTTGTAGCTGATCC
AGTTCTTGCTCACAGACTTTATCATCGGCAACACCAGCACGTATACCAACTGTGACACCCCGCTGAGCGAGGTAAAACCAAAAATGTACAGGGGATAGAT
GAATGTTAAGGCTACTTGACACAAGAAAACCTTAGTGTGTCGAGCCATATCTCGACGTATGCCAGCGTCAGACCACCAACGCCGACCCCACATATACCCA
AAGCCCACCAAAACAATTAAAACACTTGGAGGCGAAGCCACAAGCATACTGAACGGTACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGAATATTTTGCTAACTTGAGGTATCATCCGCTTTGA
AGCACCCCGCCGTTTTGACTCCACACGGATGGCGGACAATAGTTCAGTCGGTCTTGCGCTATATGAGGAGTGTTCACATTGT