Description :
From Genome Similarity Track
Location :
contig_30:152001- 153004
Transcript NameFunction/comments
g6245.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGG
GATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACC
TTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACAC
CCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAG
AATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGC
GCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCT
TCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATC
CTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATG
TACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTT
GCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGC
AAA