Description :
From Genome Similarity Track
Location :
Scaffold_1842:152- 3592
Sequence
3440 bases(100 bases per row)
GAGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCGGGAACGAGCGCGAA
GTCCGACTGGCTCTCGTCACGACAGCGCTCACGGCTCCACCGATTTGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGC
GTGGTCGTACCCAGCGACGAGGATCTTAAGTTCGATATCCTCGCGGAGGCACACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGT
CGATCTCTCAGGTCTTCTGGTGGACCCACATGTACAAGTGAGTCGCCCGGTACGTACATACATGTGAAACATGTCAGCGGGTCAAACCCACAGGGCACTC
TTCGGCTCCACTACAGAGACTGCTCGTACCGGCTGACTGTTGGAAGTCGATGAGCCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACC
GGAATTTTGGTGTTCGTGTGTCGGCTGAGCAACATGGTACATCTTGCTCCGGTTCCCGTCACTGTTCCGGGCGAACAAACCGCAAGGTTGTTCGTCGATG
GCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTACTTTACTGGGAAC
TCGTCTGCAGATGTCCACTGCAGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGTGGCA
GCACCACGGGGCTCACGCCGCTCTATTTGAACGGCTTTCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACACCTCTATTGAAAGTGAGGG
AGGGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATCTGAGACCCGTTTCGCTGCGGAAACAAGTAAAATCCTTTATGGATACCAAGCTGAGCATTGTC
AGCAGGGTCCGCGATGCCGTGGCAGCGGCCCAGGATAAACAAAAGAAGTACTCGGACAAACATGGAAGAGGAAACTAAGTGTATTTAAAGTGGGGGGGGG
GCTTAGTGTTACTAGACACGAGGAATCTGCCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTTCGTCGGACCATTTGCAGTTCTGGTCAGACATG
GTGCGTTGTACACCATCGACCTGCCTAGGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGA
CTCGCAGACCCACCTTGGCCCGGCTCCTCAAAGCGAGGGCGGGTCACAGACGTCAACAAGGGCGTCGGAGCAGGCGCCCAAGCCTGGGTCTGGACGGCAA
AGCTGCGGTCAAGAACGTACGCAGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACACCGAGTACGCTGAGTACGCCGGGGACGCACCATACGCGTA
CGTCTTGGAGTGCGTCGAAGGCGGCTCTGGACGTGGCAACAGAGCCTCGATCCGTCGGATCATGCGAAAGGTCTCGTCCAGATCGGTCGAAGAGGCCCGG
CGATCCACCCGCAGATGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCGCAAGGCGAGCAAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGC
ATCACCGCCAGTCCCAAGGTCAAGTGCAATTTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCCGACCCGCAGCCGGAGAA
CTCGGACGAGAGTGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGATTGGAGAAGACCACTTCCACGTGG
AGCGGGTCCTCCAGGAGCAACGGCGTCGCGGTTAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCTACTCCAAGAGCTCGTGGGAGCCGATTGAACG
GCTCCTGATTGACTGCTCGAAGGCTGTCGCAATCTGGGAGCAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGACCGAACGGGGTACGGACG
ATGAATACACTCCGTACCCGCGCTCATCGTGAGCGCGGGAAGCCGCACGCTTCAGGATGTCCCTTTGCAGCATGTTCTTGCTGACCAAGTGGGCAAACCG
AACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCGTGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCTACCCACGCC
CAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCT
TACGACAAATCGTGAAGTCCATCAGGGGGATGCGGTGTGGCGCGAGAAGCACACATCGAGCAGCCTCCAAGTTGTCAATGAACAACTGTTCTTTCTGAAC
AAGGGCACGTTCGTAAATGCTTCTAGAAGTGTGGCCACCCACAAGGCCACGAGGAGCGACGAGAACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCG
GGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCAGGCTGACGGGTGCCACCACCGAGCCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCT
GCTGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAGAGATAGCACGCTCCTCCTCCTCTTCTTCCCCCTTCTCCTCCTCTTCATCCGAGGTGTCGAAGAT
GCCCCGATGGGGGTGCCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACACTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTA
GCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTTCCCTTGGCCTTGACGGCCGGACCCT
CAGAGCGCACAGACGTTCTGGGACTGTAATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGGCTCACTGGGCACTGGGCTGTGTCCTTCC
TCAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCAAGTTCTACGAACCGAGGGCTCAGACGATTGT
CTGGAGAGGCCGAGGGCGACGGGCTGCGGCGCTTGTTTGCTCGCTTGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGC
CTCCTTGAGTTTTGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGTTTGCGCCTTCCCGGCAGCAGCCTTGGAGCGTGTCTTGGCACCGCTCTTTGCAGTG
CCACGAGGCATGGTAAACGGTCGAAGTGGAGACCTAGAAG