Description :
From Genome Similarity Track
Location :
Scaffold_1766:152- 1749
Sequence
1597 bases(100 bases per row)
CCGAATcacgacgacgccgaagcAGCGCTTCATACATGGACGCTTGAGCACGGCTACAACGTATCTAGACGTAGAGTCCGGTATGTTACAAAAACCAACT
CCAAGGTAGTTTGGGCACGAAATTTTGAATGTGATCGCGCTGGCGAGCTAAAAAAACACACGGCAGATTGCTGCTGATAGCCGTGTTCGCACTAAACGCG
GATCAAAGCGAATCGGCTGCCCAATGAGGATATCTATACGAGCTGTGGACAAGCAGGAACCCGATGGAGAGTGGGGGATATATCATACCGAGAGAAGTGA
GTTCCACAATCACCATGCCAGTGAAGACCCGAGTGTCCATGCTGCTCACCGCCAACGCTCTTCGCAAACCTCCAGAGTTACCGGGGAGACTGAAACCGTG
GAGAGCTTGGTTGAGgctcaagttgcagttggaATTCCGCCGTCCCTTATTCATGCAAGCCTTCATCTATCTCATCCGGCTTCGCTTTTAGCACGGAAAG
ATATAGCCAATGTGAAACAAGATGCGCGAACCCGAGAGTTGGAGTCAGAGACGGCAATGCAGGCTTTGTTTAGAGAGATGACGGATCTCAACTTCTTTTT
CAAGTACACAGTTGATCCCGGGTCTCACAGACTCGAGAAACTGGCATGGTCTCATCCTGAAACAGCAAAATTGTTTAAAGACAATGCGGATGTGATTGTG
ATGGGCTGCCACTACAAAACGAATAGATTTGATCTCCCTCTCCTGAACATCGTCGCGATATCGGGAATGAACACAGTGCTTCCAGTATTCCAAGCGTGGT
TGCCTGGCGAAGCAGAAGTCAATTTTGTTTGGGCACTAAACATGCTGCGGATTTTAATGATCGAGAACGATGCCCCTCTTGCACGGGTTATTCTGACTGA
TCGCGATCCCGCGTGTATGAACGCTGTCGACAAAGTTTTCCCTGGGGTTCCCTCGATGGTGTGTCGTTGGCACATGGTGAAGAACGTAGAAGCCAAGGTG
CGGCAAGAGCTTGGGCAAGTACCAGTGGAGAATCCTGCGCCTGGACAGCCAAAATACCAAAACTCACTCGCAGCTGACAAGTATGTGACCACTGTTTACA
CCACTATCGATTCAAGCACAGAGTCTAAGTTCGAAGAAAATTGCGCGAAACTGAGAGAGATGAATCAAACTGTGGCAAACTATCTGGTGTTACACAGGTG
GAAATACAAAACACGTATCGTAAAATGCTGGACAAATCGGTATATGCACTTCGGTGTCTGCGATATATACTTCGACAGTTGAAGGAACTCATGCTGTTTT
CAAGAGCCGACTCATGTCGAGCAAAGGTGATCTGTACACTGTGATTAAAAAGTTGCTTCCGTGGTGgtcagaagcagcaaacagcaCGCGTCATAAAATG
TCCTTCAACGAGCTGAGTACCCCGATTCAAATCCGTGGAAACGATTATGCTGGTGTCGTTCGTATCATAACGAACTACGCACTGACAGAGACTGCAGCTT
TGTGGAAAATCGCTCGGGATAATGTACTGACCAGTGCGCCACGAACTCAATGCACATGTGTATTCCGCTCGGTTCAAGGTCGTCCTTGTGTTCACGA