Description :
From Genome Similarity Track
Location :
Scaffold_988:152- 10733
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_988-abinit-gene-0.14NLR family, pyrin domain containing 13
Pytul_var.sporangiiferummaker-pug3_contig_988-snap-gene-0.9Abnormal spindle-like microcephaly-associated protein homolog
Pytul_var.sporangiiferummaker-pug3_contig_988-snap-gene-0.10Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_988-snap-gene-0.11Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_988-snap-gene-0.7Vacuolar protein sorting-associating protein
Pytul_var.sporangiiferummaker-pug3_contig_988-fgenesh-gene-0.633 kDa chaperonin

Sequence
10581 bases(100 bases per row)
ACCATTTAACAGAATGTAGGTCACTTACTGCCAGCCTGTCGTTGACAAGCAATGCCTGCCCGAGCGCGCCGCAGATGCTGTCCGAGATGTGGTTCTTGCT
GAGATCCAACTTCCACAGGCTCTTGTTGTGGCACAGTGCTTCGAATAATGCAGCAGCACCAACGCTGCCGATCTCACAGCTTTCCAACACGAGCTGCTCC
AGTTTGCTGAATCCGTGGCAGAGTGCGCCTGCGATTGCAACGATTGCACTTACGCGAAGTTGGATGTTGCCGAGTACGAGAGAGACAATGTTAGAGCTTG
GAGGATGCAGTAGATGGCTGAGCTTGACCGCGTGCGCGACATCGAGCGCCGCATTGTAGAAAATCAGCTTCTGCACGGGGCAGTTGCTGCAGTAGTGCAT
ACTGTCGATTACTTGTTCAATCAGGTGACCTGGCGCATTATTACCACCGCCGTCGCAGAGAACGCTCGAAGCCAGTGCAAACAGCTGCCTGAGCTGTGAG
GAGTTGAATGCGTTACCTCCGCTAAGAAATGTGCATAATTTGCCAGTCAGCACTCCGGCTATGAAATCCGAGGACATTGATTGGGGATACGACAATACCT
ATATGATAGTTGGCAGATCCCGCTTTTCCGAACCCGATTCAGTAGCGTGTAGAACAGTAAGGAGGGCACTTCAGCTCTCTAGAATGCAGAATGGCGTGAG
CTAGGCACAGTAAGACAATGGCAGAACGCTCATGCGAATCACTTACCTGTTCCAAAGAGAGCGGCTCTCTTGAGTCTGGTGTAGATCTGAAATCTCCTCT
CGATGTCATTAGCCTCCGCTTGTCTTCATTCAATACTGGCGCTTTTAACGCGCTCCTCATGCTCAAAGTGTATTTCTCTATCAGCAACGATTCCCATTTG
CGAAAGCATTGTTCGAGTGGTTTCATGTGCACGGATCCCAGCAGCTGAGCTTGAGCGGCTTTCTTTGCGACCACTTTGGATGCCTGCCTCTTTGCCATTC
TGGCACGGTACATCCGTTGGATTCTGGTAGCTGCTTGGTTTGCTTGTAGCTTGTCATCAATGAGAGCATTTCGCCATGCGATGAGGACTCGGAGCAACCA
CGAATTCCGCTTTTGACGCTCCAGTTCTTTCGCTCGTGCAATAGAATCGCTTCTCTTTTCCAGTAGACGAACGTACCTCCTACGAGTGAGCCATGCGCGT
AGAGCGTGTTGTATTTTTCGCGCAGCTCGGTTTTGCCGCCACTTTTTCGCTTGAATGATTCTCTTCAACTCATTGAAGAATATCTTTGCGAGCAATTTGA
AGTTTGCTTGCAAGCGCAGGAAGATCGCTTTTTTCTTCGCTCGTTTCTCCAGTGCAATGAGCAACCTTCTGCGTCTGCAAAGCGCACGCCACCATTCTTG
AATCTTTGAAGCAGAATCCAGTCGTTCTGTGGCTTTCTGTTCTGGGAACCGAGCGAGAATGAGAAAGCACAACCGTAGCACAAAGGTACGCGGTTGCGCT
TTCAAAGTTAAGTCTGGAGAGCTCAACATCCTTTCACATTCTCTTATCACTCGGACTCGTCTCCTCGCGCGAAACCCTCGAAATACGCGCTGAATTGTTA
TCGCGCAGTTCTCTCGCTTCTCGTAGTTCAGTTCTACATTTTGCTGAAATGAGAAAAACACCAGTTTCAGCAACTGTTTTACACTCTTCTTCTGCATCGC
TTGGATCGTCAGTTCAACTCGACGCTTGCGCAAACGCAGATTTCTCACAATCCTCCTTCCGCGCATACCACGGACTCGTTTCTGGATTAGAATGGCGCTG
TTGCATTTCTGAATTCGATGCCATACTGCATTTGAAGACAGTGCATTCCAAGATTTGAGCATCACGCGGTGGCTTCGGTCATACACCATCCTGTTCATTG
TTTCAGTCGTGATCTTGTGCCTTCGTAGCGCAACTTTGTATCGACGACGCGCAGCATGTGAGCGAAAAAAGCACTGAATCCTTGTTGCTGCGCGAACTTT
CTCGCGTTGAAGAAGCTTGGTGAAATCTTTCCATCCCTTCAAGACCAGGGTCTTCACACTTGCTGACTTTTTGCCGAGGCAAAGTTCGATGATTTTGTCT
TGGTTGTGCTTCTTCTGGAGCAAACGTGCGTAAAGCTTCCTGCTGAGGTATGCACGAGCATACCTCTGCATCACCACAGCCGCATTTTCTCGCTCAGCTT
TCTGGATCTGTACAAAGAGTTTCCAAGCCTTTAAAACAAACTTTCGGCCCGCTGCAGCACGATACGTAGAAAAATTTGTCAAAATTGTCGTATGTCTATC
GCGCAGCGCTTGTCGAATTCTCCTCTCACGCTTTGCAAGGAATATCTTGTGTAGTGTCTGAATTTTCCTCGCGGTGGTGTTCAGTCGCTTCATAATAATT
ATTTCGTCATGCGTAGCCATGACGACATTTTCTGCGTTCTCCTTTTCTTGACGCTCCTTCTTCAATACTGCCAACGTACACACAGCGACGTATTTCCTCC
AAGCGCACTGAATGATGCAGGCCTTGTAGTTTCTGTTTGCTTCCACAAGCAAAGCCTACACAGCAATCCCACGCATATTATAATTTGATCAGACAGACAA
AAATGACTTGCTAAATTCTTACTGCAACTGCTCGCCATTTCGTCTTGTTGAAATACCGTCTTGTGATCTGCTGGATTTTGTGGGCACTTTCATTCTCCAA
GGCAAACTGAAGCCTCCAGTCTTCACTCCAGTTTTGAAGAAGGAACTGTACGAGCTTCGAGTGATAGTCCACATGAATCGCCTGAGCCAGTGAGCCAACA
GCGGCTATTGGATCTCCTATTCGATGCAAGCAAACACCTTCGAGCACTAGCATATCCATGAGCAGATTACCATTTCGCTGGCGGACGACTTCCAACGCTG
AAAGTGCCAATAATGGGAAATTGAGTTGTGCCATTTTCTTCGCCAGGTCGAACCACGTACTGTCATCTTGGTACCAATGCTGCATTCGTAGATTTTCGTT
TTTCCTCGAGCTGTTGTAGATTTCGTGCGCTGCCTTTTCTGAAGCAGTAATTGGCGACATCGCAATCATCGCTTTGTAAGCCTGGCTGTACGACTCTCTC
ACGAGTTCTTGCATGCCAGACACCTTTTCAAGCTCGCGTGCAGCTAGGAGATGAAGGTGATAACCATTGATTCGATGAGGTGGTTTCTCCACCAGATACT
GGAAGTACTGTGCACTCTCTTTGTGCTTCCCGAGTGCTTTTGCCGTGACTGCAGATAGAAAGATCGCTTCGTTGACGTGCTTGAAATGTGTGTAACCTTC
AACCAAAAGCGTGCAGACCGATAGAGCACCGCGATACGCAGCAAACTCGATATATAGAGTCGCCAGCTTTAGAAGAAGCAGTGGGTTTTTCTTGTTCTCA
GGGTACTCCATCGCGATGATAAACGTATTGTACGCCTCCTGCAGAATTATGAGAGTTATAGCTTAGGCATATCTTGTCCTTTAGTGTATCAGTCCATCTT
ACCTGAAGCAAAGACGAGGACTGGAGGGTTGAAATTCCTGTTTTCGGGTCACACATGAGAGCCAAAATGGCTTCTTTGTGCATGTTTGTGACATACAGTT
GCCACTGCTGGTGCTGAGTAATTGCTAACTCGCTCCATACCAACGCAGAATCTTCAATCTACTCCATTTTCCACATGAAAGTTCAGCAATCTTGTGAACT
GCGCCACGATTGAAATAATAGATGTGCCTACCTCGATCGCTTTTTCCAGGCCTCTGATCGCGTCGAGATACCTGCCATTGTGACGGTCTCGAAGCGCTTC
ATCGAACGCTTCTTTCGCTCGTGCGTCTTTAAAAGAGCCGAGTCCACTATCGGACGGTATGTCCATTACTTCGCATCGTGTTGATCAGTTGAGTTGCTCA
TGGCATTTTCTTCGCTTGATACATTGGTACTGCTTATTATAACAGTGACGAAGAGCAGATGTGTATATATATAGCTGCCGCTGCAATTATGTGGACACAC
AGTACATTTACGTACACACTCATGTTCACATTTTAGCATTCCTTTTCATTCCTAGGAAGCACTGGCAAGTTTTCGAATTCACACATAATGCGCCAAGCTG
CACTGCATACCTCAACCAACTCGAGACTCTCGACACAACTTCGAACCAACGTAGCTGCAATGTGAAATTTCTGTAGAGCTTCAACACGTTTCGCGCTGGT
TCCAGCTGGCAATCCTTGACTTAAATCTTCAAACCCAAGCTGCTGAGGCGTTTTGGCGATTTCCTCCTCCACAGAGCAAAAGATACTTTGGCATGATTTG
TCTTTTTCGTGCTCGATGTGCGCTGGACTCAGAAACTCTCGCAGCAATTGCAACTTTTGAGATGCAAAGTTCGGATCTTTCAAGAACTCCAAACTTGACT
CTTTTACAGAAAGATATGTGAAGAGTGAGAGCAGGCTCGGGAACTGCATATCATAGCTGAGATCATTCGTCGAGCGACAGAAAAACAGCAACTTCTTGAA
AGCCACATCTCCCCAATGCAGCGGACTCAGTAGGTGCTCAACACTTCGTAAGTTAGGCTCATCAAGCACTCCACTCATTGTGACGAAGCCTGTGATAGAA
TCATTCAAGGATCCTTACACAAATCGCCCAAGGCGAACTCTCAGTATTTCCTCCTGCAGGTAAAGGGGATGCATCAGCAACCACGTACCTAGTCCAACTC
GATAAGCCAAGTCAGCAATATCAGCTGCAGTACACTGCTTGTAGCACTTTATAAATTGCTGCAATGACAAGGTCTGGGAGTCTGGAAATATTGTCTGAAA
TCCGATTTCGTCAATGGCACTTTTTCTAAGAGCTTGCTGAAGTTTGTTGAATTCCTACAGAAAGAAAACTCTGCGTTAACAACAGTAGCCAGAACAAGTT
GCATTTCTTTACTGACTTGAAGATCCAGCGTCCCGTTGCGGTCAGCATCAAAGGACATGAAAATCTGCTTGAGAACACTTTCTCTATTTTCTCGCTTCGC
GAGGTTTTCGAGGCGAGAAGCGATATCCAACCACTTCTCCACAAAATCATCGGCAGATTTATCAAGCTCCCCAAGAATAAAGAAGCTGTGAACAATCGAA
CCGATCTTGATACCATTTTGATGCTAATACAAATACAAATCGTTTAGTATATGCTGGTACACATCCAGTCCAGATCGCCGACTTACTCACCTCAAAGCTA
GCGAAATAGTCATCGTTGAAAAGCAGACAAATCCGAAGGTACTTGATTACAGATGGGAAAATGCCAATGGGCCGAATTGTAGTTCCAACCGTGACTGCAT
TATTTGCATCCAAGTAAGAGAACTAAGCAAGCCACATTAGAGCGCATTTTGTTCATACCTTGACAGGACATCCATATGGGGGACAGAAAGCACCACACTT
GCTCATCTAAGAGATACTTTTCCACAGAAGATGCTAGATCCATAGCCTCCTCGTCTGACCCAAAACATTTCAGAAATTGAAGAGTATTGCTGACAGAACC
CAAAAACGCAAGCAACTCTTACCAGTAACGCTTTGCTTCATTCCAAAGCGGACATCCAGAGCCATGGCGGCATGGCCGTCCGGATGGTATTGCGTTGTTG
ACGTTGAATGGCTCTCTTCATTGGGCGGATGAAATCCGAGTCGAAACTTAATATTCTTTTCTGACTTTGTTGACTCATGAAGTTGGCTGGCTTGACCGAT
CCCAATCTTGATGTTGTAGTGAATTTCGTCATCTCTGTACTCTGATTTTCCCCTGTCGTTGCCATCCATGTCGATGCCGACAAGCTTAGCAGCAGACTTG
ACTTCTTCAGGAAGAATTTGAATAGTATGAGCACTAGATTGAAGAAGCAATAGTCCCTTGCTCATTTGACGCTTGACAGCTTTGACAAGCTGAACTCCAC
GATTTGCGACTATTTCCCAAAACGTCCCCCTTTCTTGCCTAGTTTCACGCAGCCAAAGTTTCATGACTCGAATGATTTCGCCACATTTCGCAAGGCCCAG
TTGATCCACAGTCATTCGGCGCATCAGATCATCTGCCTTTGTAGTCAAAACGAAGTTATGGGTTATACAGGCTATTAGTAATCAAAGCAATTTATCATGT
AGTAGACGTACCTCGGCTTCTTGAACTTGCAGCGCTCCTTCGGATATGCGACTAATCAATCGCTGGATGCATCGCCTATCTACTCGTTTCTTGATATCCG
CCATCTTTGCAGGAGACGTGTCATTATCTAGAGCTGTGTTTGGTGAAGAATTCTTGTCGTTGGTCTGTGGTGGACATATAATGTTCTGCAGCTTCCGGAT
TAGCACATCAACGCTTGGAATTTGACCTCCTCGTGAAGGCGTTTTACTGGCAATGAGAGGTACTGGTACGAATGACCGATCTAGGTGTGTTCTGCGCTCA
TCTGTTTTAGGAATTGATACAATCGTTGTTATTGACATGGTAGTGTAGCATTGGATCCCAAGGGGTAGTGCTTTCATGCAGCGTACCAGTCTCGCCTACG
CGAGCAAACTGAAAGTCGATGTACCCCATGGTCTGGGTTAGTTTCGCTTGTTGTGCCAGCAAACCGTCAACTGTAGTCGCAGTAGCCTGCAAGGATGAAA
ATGCTTAGGTCTGTTTTGTTACACAGCCGATGAGTCGTAAAATATCTCTGTATTTACCGCTCCCAGGTCGTTCATGAAGAAAATGATCTCGGTATCTGCC
ATCGCTCGATCAACGACATGCTGTCGCAACACTTCCGTCCCCTCGCCAAGCAAGCCTGATCGCGCACAAGCAAATGCAATATTAGACTGTGTACCTGCAT
GCTTCTATGGCATGCCGGTGTGTACACTTAATCGTACGTTTTGCCAACGGCCGCATCAGTTCCTCGCGGACTTCCGGCACCGACTTGAACATCGTCAGCC
CTCTCACGGACGCCATCAGCACCATCATCAACTCGCATTTGTTCACAGTCTTCAGTCCTCCATTATCTAAAAGGGACAGTATGACTATAGGCTCACAAAC
AATCAACACACGCCATCTACGGTTCGTATCGGTACGAAAAAGAACAAGACATCTTCATGCTTCAGGTCCACAACGACATGCACACACGCACGCACATTCG
AACTTGGCCGACTTTTTGGCCTCAACGACAAGCGCGAGCCCGCTGAAGAAGTCCATCGCGACGAGCTTCCTCTTCTGCCGGCGGTCGAGCAAGTCGAACG
TCGCCAGCAGCTGCGCTTTGTCGATGCTGGCGGCCGCGCACACGGGCGTCAGGATGGCCTGGAAGACGTTGAAGGACAAGAAGTACTGGCACTGCGGGTC
GGTGCGACTGCGGCGGTGCACCTCCTGCTGATAACGCAAATGCAGCTGCTCGAGATCGCTCCATTTCGGCGGCACGATGTATTGCAACTCCGTGCGCACG
CCGCCCTTGGAATGCTTGCTGCCCATTGTTCTGCACTCTCGTTGAAGTTTTCATGAGCAGTCCTTTCATGATACTGGGAAGACTTGCATCAATGGATACC
CTGCACGAAACGATGGAGACATAGCATGGATTAGTAAGAGTGAAAATTAGTAATGCATTGATACCTTCATAAATGAATGTAGCTATAATGCTAAAACCTT
TCACAATGGATCGTTTTGGTCTGTTGCCCAGTATCAGTCAGTGTTTGTCGCTGAGAGTGATTGTCAGTGCAATTCCGCAACGAGACTACCGTACAGTGCG
CGACACAACAGTGACTACAGGAATGTTGGTCAAATGTGATCTGGGTGCACACACTGCCTATTTCGGGAGAACACACGAATCGGTAAGTGGCGCATTGAAG
AAAGAACGCGGGCGTAGGACACACGGCGCGCGAGACGATGGAAAACAAGTTCATCCCGCAGGCGATCGAGATCGTGACGCAGGCGATCAATGAGGACAAC
GGCAAGAACTACGAGGAGGCCTTCCGCCTCTACAAGAAGGCGCTCGAGCACTTCATGGTCGGCGTCAAGTGTGAGTGTCTTCTATTTGCACAACATGCAC
GCAATTCAAGCGTCGTGAGAACGAACGACTACTCTAACTACGAAATGCGCACATTGGCATGCCCTGGCTGGTATGTGCAGATGAGAAGAATCCGACATCG
AGAGAGATTATCATGAAGCGCGTGGAAGGGTACATGACGCGCGCCGAGCAGCTCCGCACGATGCTGCACAAGACCGACGCAAAGCCGGTCAGCGCTGCCG
GTGGCACGGCTGAACTCGAAAAGTAAGAGTGCGTTGACGCGTATTGTGGTTTGGATGCTTTTATTGATTTTGGTTGTTGTTCGTGCTTTCTTCATTGCAG
AGGTGATAAAAGCGATGACGACGAGAACGACGCAGAAACCACGAAACTTCGCGGATCGTTAGCATGTGAGTGTAAATAAATTTATTCTGCATGCGCCGTT
CTTCTGCTTGCTTATACTAGGAATGCTATGTATATCTAGCTGCTGTTGTGTCAGAGAAGCCAAATGTGAAGTGGGACGCTGTGGCTGGTCTGGATGCAGC
AAAGGATGCCTTGAAAGAAGCTGTGATTCTGCCAGCGCGTTTTCCGCAGCTGTTCACTGGCAAGAGACAACCCTGGAAGGGAATTCTCTTGTATGGGGTG
CGTGTGCATGCGATCACTCTGCGATCTGATGATAATGATGACCACTGACCTCTTGCGTATTGTTAAACAGCCTCCTGGTACTGGTAAATCGTACCTTGCC
AAAGCAGTAGCAACCGAGGCCGACTCGACGTTCTTCGCAGTCTCCTCATCAAGTCTTGTATCCAAGTGGCAGGGTGAAAGTGAAAAGTACGTTTACATTA
TCCTGAGGCTTTGGTTATTGCTCCTTAAACTGACTCAAATTGTTTGTGAATACGATTAGGCTTGTGAAAAACCTGTTCGATATGGCTCGCGAGAAGAAAC
CTTCGATCATCTTCATTGATGAAATTGATTCGTTGTGCTCGAACCGTTCCGAGGGCGAGAGCGACTCGACCAGAAGAATAAAGAACGAGTTCCTAGTACA
GATGCAAGGTGTCGGCAACACCCATGATGGCATTCTTGTCCTTGGAGCTACGAACGTGCCATGGGAATTGGATCCAGCTATGCGAAGACGGTAAGATTTG
CTGCTGTGTTTGTTCTCCTGCTCGGTCGTGTTAGTCTGCTTACTGAGTTTATGTGCTGGTAGTTTCGAGAAACGTATTTACATTCCACTCCCAGACGCGG
ACGCGCGAAAAGTTATGCTCAACATTCACTTGGGCGATACTCCGCATGCGCTCACGGATGAAAACTTCACAGCTATTGCTGAGCAAACTGAAGGGTACGT
ACCCTTGTACTTGCAGCTTGAAATGACATGACGATCGGACTAACTTGTGGCTACCCATGATTTACTTGTAAATGTTAGATGCTCGGGTTCTGATATCTCG
GTACTCGTGAGGGAGGCGTTGATGGAACCACTCCGAAAATGTCAGCAAGCGCAGTTCTTCACGCGCGTAAGTGCATTTGCTTTGGCTAGTTTATCATCTC
TGCATATTCTTATCGAGGCTAACGTGCTGCTGCTCTCGTACAGTGTGATGACAAAGCGCATCCAGCTCGAAATGGCCAGTTTTTGACTCCATGTGAAGAC
GACCCGCCGTGCGCGTATTGCCATATGAAACTTTCGTCGTGTCCCCGCAACTGCCCGGATTGCAAAGCGCCATGTCGTCGCTGTGGCGCTCTCCGCATGC
GTCTCTTTGATCTTCCAGAACGTGGTTTTTCGGACGAAAAGTTGCGCCCGCCAATGATCGCAATGGTATGTTCGCTGCTCAGCCTTGCGCTTACTAAGTG
GTTAATTAACCATGGACTTTATTGATACTTTGTTTAGAGCGATTTCAAGAAGTCAATGGAGCATTCAGTTTCGAGTGTGGCGCCAGAGGAGCTCAAGCGC
TTTGTAAAGTGGACGTCCGAGTTCGGACAGGAAGGCTAGAGCGGTTAGTGAGTACGTTTTCGATTATCGCATCATTGGTTAGTTATTTTTTCTTTCTTCT
TCTTCAATCGATCATCATGTATCTCAATGAGCATTGCATTTATTCGTTCGTCTATTTGCTTGTTTTTTGTTATTTTCTGACAAAAAAATACCTTACGCAC
TAGACCCTGTTGTAGACAACTCAGCCGCGATGCTTTTCAACTCGTCCAGCGGGAACTGGTACACTTCATTACAGAAATGACATGTGAGGTCGACGCCTTT
CTCGGCCGAATCCTGGATCACGTGGTTCAGTTCACTGGCACCGAGCTCCTTCAATCGGTTGGCAAACCCCTTTTTCGAGCACCGGCAGAAGAAATCCAGT
GGGATCTTCTTGCAGTTCTTCTCCGTCAAGTCAGCCTTTGGGATCAGTTCGTTCAGGTACGCGAGCAAGTCATTGTTCTCGTTGATGGAGCTCGCGAGCA
GCGGTACGTCGTCAAAGCGGAGGTCGTCAAGTTCGTAGAACTCGCCGTGCGGAGCTGAATCGGGCATTTTCTGGATCGTGATGCCGCAGCAGTGCGCGTG
TTCATCACTTACGTCGCTACTGATGCGCACAGCCGTGGGTACCTGCTCGGAGACGTCGTAGAAAGTCTGCCAGTCAGCCTC