Description :
From Genome Similarity Track
Location :
contig_30:151971- 157057
Transcript NameFunction/comments
g6245.t1hypothetical protein
g6246.t1ETL32185.1 hypothetical protein L916_15179 [Phytophthora parasitica
g6247.t1hypothetical protein

Sequence
5086 bases(100 bases per row)
TAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGTTCAGGAA
CAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACACAACCTA
GAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAACCACCT
CTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCG
TGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAACCGATCG
AACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAATCCTTCA
CATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAA
GGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAGCCAATG
CGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCACCAGCA
AACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGAGACCGCT
GGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTTGTTGTAC
ATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAATGGGGGCG
CCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTTGGATGAC
GAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTTTTCAGCT
GCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTTCTCTGTCTTCTTACCGTTAGCAGGAGTCGTCTTGG
TATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGTGTCGGTCTTTTCAGACGCTTTCTTCTGCTC
AACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTCTTCACTGGCGTCACGGGCTTCGTCTCTTTC
TTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTTCAAGGCCATGGGCAGATCCATGTCGCTGTCTTCATCTTCCT
CCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAGCCACGGCCATATACCAGCAGCAAAATAAAG
AGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTCCTGCATTTCGACGTCCTCGGGCTCTTCCTC
CATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCTTCTTCTTCTTCTTCTTCGTTTTGCTTCTTC
CTTTTCTCTTGTGGCTTCTCTTTCTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGTCCGCCGGTTTGCGCTTCTTGGGGGACGACG
TGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGCACATTTGTATGTGAGTGAAATGGGTCTCCC
CCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCAGCCAAAACTTTTTGGCGCGCTCCAAAGTGT
ACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCTTTAAAAAGGGTATCCAATCGTCAGAAATGG
GTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGATGCGACGGACGCTCCGTTGCTCTCAGTGGT
CGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCACCGACTGCTGGAGCTGCAGCGCGTGCAGCCG
CCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCACCCATGGACGCGCTTTTTGTGCTGCTGGACG
CTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCTGCTGCAGCTCTCGACACTAGACCAAAAAGT
GCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTGAATGCGGGTAAAGTTACAGGGTGGTTAAGG
TCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCGCGGAACAGGTAAATGTACCAGGACAAGAGG
GAAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGTGGGGAACTACCTCCCGGAAGAGTGGATCGA
GCTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTTGTTTGTTAGCTAAACGAGTTCTATTTGTTGTTCTTAAGGGTGGAGA
CGGAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCGACGTCAGACACCCGAGAGTGGGTCCAAGCG
CTCGACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATGAAGTCGCTGACCTCATTCTTCGGCAAGAAG
TAGAGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTCGAGCCCTCCACGCTCACCCGGTGCACTTGC
ACGAAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGCTTACAATTTGCATCTCTCCGTCGGTCTCCT
TGAGCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGCATCGAAGAGCTTCTCCCATTTGGTCGGGGT
TGGTCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGTTGCAAGCTGAACCACGAGTTCC
TGAGGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTACAAACGCAGAAGCAGGACACAC
CATACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGCTCCATCGCGAC
CGAGACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTTAAACTTAGAACGACGCCACAAG
AACAAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTTTACTTGAACACCCTCCTAGATA
CCGACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTG
CCCAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCTCTCGAAACCCGCCGACAAAATG
TCGGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCT
TGACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCATTGGCTGCTTCACCACCCGAGT
GTACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAGGCACTTGTCCAGCAAGCCTTGC
TCTGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCA
GACACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCT
ATCTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTCTTCTTCGT