Description :
From Genome Similarity Track
Location :
contig_30:151970- 153419
Transcript NameFunction/comments
g6541.t1hypothetical protein

Sequence
1449 bases(100 bases per row)
AAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGT
TCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACA
CAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCA
ACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAA
AATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAA
CCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAA
TCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCT
TGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAA
GCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTC
ACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGA
GACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTT
GTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAAT
GGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTT
GGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTT
TTCAGCTGCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCG