Description :
From Genome Similarity Track
Location :
contig_30:151961- 152964
Transcript NameFunction/comments
g6541.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATG
ATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAG
AATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGG
TCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGG
AGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTT
GCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACA
TTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGA
AGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTT
TTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTC
TCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCT
GGA