Description :
From Genome Similarity Track
Location :
contig_30:151940- 154893
Transcript NameFunction/comments
g5296.t1DNA ligase, putative
g5297.t1conserved hypothetical protein

Sequence
2953 bases(100 bases per row)
TTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCT
GGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGC
CAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCG
TCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTC
CTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCAC
CAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAG
GCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCG
CACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGC
GATCTTGACGAACTGATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGAT
CGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCA
GGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACG
ACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATAC
GGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTCCTCTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACT
CTTTATTTCTCTGTCTTCTTACCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATG
CCTCCTTCTTCGTGTCGGTCTTTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTT
GGGACTCTTGGTCTTCACTGGCGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTC
TCCAAGGCCATGGGCAGATCCATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCG
AACAGATAATCAGCCACGGCCATATACCAGCAGCAAAATAAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTA
TGTGTTCTTCTTCCTGCATTTCGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGT
CTTCTTCTCTTCTTCTTCTTCTTCTTCTTCGTTTTGCTTCTCTTTTCTCTTGTGGCTTCTCTTTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCG
CCTCGTCGTCCGCCGGTTTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGT
CACGTGAGCACATTTGTATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCA
GCAATTGCAGCCAAAACTTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGC
GGGAAAGCTTTAAAAAGGGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTT
CCACGCGGATGCGACGGACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGC
GATCGGCACCGACTGCTGGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGC
TGTTTTCACCCATGGACGCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAA
CACATGGCTGCTGCAGCTCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGAGAAGACGGGGTGGACAACCTCTATG
TGAAGGTGAATGCGGGTAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGA
CGCGTTCGCGGAACAGGTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTG