Description :
From Genome Similarity Track
Location :
Scaffold_751:15193- 16502
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_751-abinit-gene-0.18Conserved gene of unknown function

Sequence
1309 bases(100 bases per row)
CGCGGAGCGAGGTCTTGGCGATCGCGAGAAATACTTTCTTCTTGTTGATTTGCGATCGCTGCAGCTCCTGGAACACGACGACGATCGCGCGCATGAACGC
AACATACTCACAGGATGCAGCGTTCTCGTCTTTTTGTGCAGCGAGACGCTGGACAGACGCCGTCAATGCGCGATGCATGAAATCTGAGAATACGTTGGTT
GGTGGCTTGTAGAGCTGGAAGGTCGGGACTGCGTCCTTGCTCTTCTCGAGTTGCTCCGCTGGCAGGCCAAAGAGGTACAGAAGCACGTGCTTCACATCAA
GAAGCACATCCAGTTCTTCGTTGTCATCGTCATTATCGTTCACAGCTCTGCTCGCCTTCTCCAACACGTCCGCCATCGCCGCGAGCAGCAAGTTGCTCGA
GTTGGTCGGGATCGCGATTGCTTCGCTGTGCTTGCGCGTCGCAAACACGTTGAGCGCGAGCCGCAGCAGGCGCAGCGCGTGTTTGGTCTGTTCGGGGCGC
TCGGCGTCATCACGCTTCGCCTTGGTGAGCAGGAAGATTGCAAAGTGCACCGCTTCCGTCACGATGCGGTGCCATGCGACGTTGAACTCGCACTCCGCCG
CGTCCAGCAGTGCCGATTGCGGTGCGAGCAGCGCAAAGCCCGTGCGTACGAGCTGCGCGTCATTATCGTAGCCTCGGCGCGTCTGCTTCCAGCGCACGAG
CGCGAGCGTGTCGTCCCACGGGAACGCCGCGGGCGGAGGAGTCGCTGGTGTTGTCATGCGTGATGCACACGCCGCTTTGCCTGTTTCAAAGTGCGAAATT
GCAGAATGGCTGGCCAGTCAAAACCCCGATACAAAGCTGGGTTTCCGAGTTGAGTATGTGGACCACACAAAATACACTTAATGGGTGATTGTGAACTTGT
ACACAGCAAACTTGGCTAAATTGGATTTGACCAGCTCAAGTTGGCTCACAAACACCATGGCTGCACTTTGAACAGACAAACAATTTGAGTATGGCTACAT
CTACGCGTTTCCTGCACTACTATACGATGAATCCTTTGCTGCCATTATGCTCCCCACTCGAGCATGTGCCGCCTACACGCCACTCCGCTTTTCCTCTCAG
ATCACCTGTTGAGAGAGTTTTTTCTTCGTTGCTTCGGTAACGTATAATCCCTTTATTGGCTACAATTCTGTCTTTATCTTGTCAAGAAAGACGAAAAATT
GATTCCGATTGGCGAAAAATCGACCTTGTTCATGGACCATTGTTGCGGAGTGTGCACTGGGAAATAGTACACAATATAGTGTTCATGAGACAGGATATGA
CCCAGGTCA