Description :
From Genome Similarity Track
Location :
Scaffold_136:151919- 153558
Sequence
1639 bases(100 bases per row)
CGACGAGCTCGAAGTCGAGAAGATCACCGATATGCGGTCGGGGAATCGGGCTAGATACGGACGGATTTACCGTGAATTTCTGGTGCATTGGCGTGGATAT
GACGAACCCAGTTGGGTAGACGAGGTAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGTGTGATGC
AGTCTCATGAAGAAGAGTAGGGAGGGGATCCATGGATGTGAGTTGGTCATGTCGATGAGAGGATGAAGAAGGGCCCGCAAGAAAGGTGTGGGCCAGGAGG
AGGAGGATCGCTGATGTGAGCTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGTGGATTAGGAGGAAGGAGTGGATGTTTATGCATAAGAGTG
ACGTTTTACGTGTGAGGAGTCCTGCTTGATCTCGAGCACGAGCTTTCAAGGGCCCGAACTATACTGACCCAAGAATACACNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCACTGGATCCGGGATC
TCGCCCAGATCCAGGTCCTTTTCTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAGA
GGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATTCCCCCCAGATCCAGGTGTA
CACTGAAAGGGTGGATCCCGCTCAGATCCAGGTGTACACTGAAAGAGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGTCCAGATC
CAGCTGTACACTGAAAGGCTCTGACTAGATTTCTCAACCAACGAGGGAATGTTATAGACATATTCAAGTAAGAGAGTGTGGATTATGATAGCTTATGCAA
AGGGCTAGCTCGACCCAGTTTCCAGTCGCTAGTTACTGCTACGAAATGAATCCACGAAGACTGAAACTGGGGGCGCGGCGTCAAAGAGTGATGAGGATCA
GGTAGTCTTGGGCTGAACGTTGAAGAACTTGCCCATTAGACGCTGGATCTGGTGCCCTGGGTGTTGGCTCGGGTCCACGCCAAGGCTCAGCTTCATCGAT
CTCTTCCAGAGCCTCCAGTAGGTTCGTGGGTTCTGGGCGGTGGAGGTTGGGATCCTCCAAGTTAGCTTGACGGGATACGGATCCCGGAAACCAAGCCACC
TTATCCCCGCGTCGGGGAAGATGCAAGAAGGATGGATCCAACAAAATATCCACGTCACACCCAACGTCCTGGGGAGGGGGTTTTAAATAGAAAAAATATA
AGGAATTTCCTCTTCCAAGTTTCGGAACGGCATGGGTTATCGTCCGTTTTACCACCCCTGTCTGGTTGAAAATTGGAACAAACCCAATCCAAAACTCGGC
CGTTGTAATTCCCAGAGAATGGGTAAACCGCGTGGATGCCCTCCCCAATAAACCACCGGTGCTTGGAGACGAAATCCCGTGAACGCACGAACGAATACCC
CGAGTCGCCCACGCACATCATCCCTGAAGCTAACCGGAT