Description :
From Genome Similarity Track
Location :
Scaffold_93:15191- 21281
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_93-abinit-gene-0.29Nipped-B
Pytiw_DAOMBR242034maker-piw_contig_93-fgenesh-gene-0.7TBC1 domain family, member 7, partial
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_93-abinit-gene-0.42Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_93-fgenesh-gene-0.3Aspartate aminotransferase

Sequence
6090 bases(100 bases per row)
TTTCGCATATCTAACATTGTTCTATTTGTGATAATGCTATAGCACGACGCTTGAAGCTGCAAAGCGGCTGTTCGCGGATGCTGGTCTCGCCCCCGACATC
ATGGCAGACGAGGACCCGGATTTTTCAGACTTCGATGTCGTGGATTATCTTCCAGCCGTGCACGTCTCTGATGGCGAAGCGCGATCTCTTCAACAAGAGT
GCCTGACAGGGTTTGCGATCAGTTTGCTCATTCGAGCCAAGTTTTTTCTCAAAGAACGATACTTGCTCGACAACGAGAAGTGCATGACATACCAGCCTGC
AAACTCTTCCAAGGTGAGATTGTATGTGCTCTCTTGTGATCAATTTTTGCATGGCTAACTAACGCGTCTCAACTCTGTGATGTATAGGCAACTGACCAGC
CTGCAATACTGTCCGACCGCATGCAGAAGCTTCGCGTGCCATCAGTGTCTGACTTCACGTCGGCAGCAGATAACCCCGTGGAGCTAAGCTGGAATCTCTT
TCTCCAGACTTGGGAAGCAGCGCGCGACGACCAGCACCAGATTGACTTTGAGGTGCAGGAAGATGCGTCGAGCAAGCTTCGGAAGAAGAAGGGACGACGC
CGCAAGTCCGTGAGTGTGAAGCAGACCACCAACTCCGCTGATGACGACGACGATGATGAGTTTGTCGAAGGCTTTGCAGGCTGATCGCATCGCCACCAGC
TAGTGCACCCAGTAGCGTAATGACTTGGCATCTCTTTCTTTTTTTCACGACTCTTTATCTTTCTTTAGAGCCTCCAGGATGCGAATGAACAGCACTTCCA
AGTCCGCCACGCAGCTCACAGTCTCGTGAAAGCTCTGCAGAGTCATGACAGGCTTGAACTGACCCATGCCGTCATGGAAGAGCTCGAGCAGCTTGGTAAA
GCACCAGAACCGTTCTGCATCTCCTGCAACCACTTCGCAGATCATGCCCGCCACGCGATCCAGATACAGCTCATCATCCATGCCTCGCAGCGGTTTCCGC
ACCATGATGTCGCTCCAGTAGGTCCGATGCAGCTGAACCAAGCAAGTGCGCTCCTTCTTCGACACCACCTTTGCCGTCTTGCTCGGCAGCGGTGACAGCT
CGCTATTCGCACCAGCACCGTCCGACAGTATCGCATGCTCCACCACATCCGTGTGTGGTTCCAGTGCACCGTCGTCATCTCCACAGCAAGGAGAGCCGTC
TTCAACGCAGTTGTCGGCACCTGCTGCTGCTGCTAGCGTTGGCTGCAACACCTGCGCCGCGTCGACCACATCCTGGTACATGATTGTGCGCTCCTGGATC
GCGAACTCCCAGATGGCCGTGTGCGGCGGCAGCACGCCGCTGAGCAGCTGCCAGACCACGTCGCGGTAGTGCGCGGGAATCCCGATCTCCTGCGCGAGCT
TGACAGCCTGTGCGCGGTTGACCACCGGCTCGGCGAGTAGCGCGGCGTACGAGGCCTCGACGTCCACGATGTGCTGCACGACCGGCACGCCCAGCGTCTT
GTAGTACGTCGTGCGGAAGTTGCGGCTCAGCGCCATGCTTATCCTGCAAAGTGTTGTTGTGTGTGGCTCGTGATTTTGGATTTGTATCGTTTCTTGAGCC
AACACACCAACCGAACGTAACAATGCGTATCTAATGTTACAATGCGTATCTAACGCTGGCGAAAACGAACTTTAGCATTGTATCTAAAGTGGACGAAAAC
GTACCTTGCGTGCGTGCTATAAGCTGCTTCATATGTGCAAGTCTAGCATACATATTTCAAGTGTAATCCTTAAAATGACTCGTATTAATTGAAAATTATT
TCTTAGTTTTTGTATAGTGCAGATCACCGTGGTCGGCGCTGCACTCCATTGCACTGTGCGAGAAACTGAATAAGCAAGCCGAGCTTGGTATCTCGGCTGG
AAGGAGCACTGGCGGCGGCAGGATGTCAAAGCAGTAACGGCAGCGCTCACGGCGAATTCTGTCTCGATGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGAGAAGCTCGTCGCGGGTCTCACAACCAACGTTGGACGAGCTCTGAGCAAGAAGAGCTTAGGTTGCTGATCGCGAATTTCACGT
AGATGCGTGTGGGACTCGAAGCAAGTGTGCGTCACCTGCACACAAAATGGGTGTACATGACGAAACGCAATGGAGATGAGAGCATCGAAGGGTACAAGAC
CAGGCTGGTTGCGTGCGGAAACGAACAAGTTTGGACTCGATTTTGTCCTGACTTTCGCTGCGGTACTCGAGATCGGAATTGCAGAGTCGTTTTGTACTGT
CCACTATCTGGCGAGTGGCAACTCGGTACGGCGACGTGCCTGTCCCTACGTAAAGACAACAACGGAAACGAGTAACGATATTACTTCTCGAGTGGGCTTG
AGGTCCCAGGATACATGATGGCGAAGCTCGGCGCATCGCCGCACAAGAAGATTTGTCTGCGCCTCGACATAAGCATATACGGTTTGAATCAGGCTGGTCT
AGTTCCTGCACAAGACATTGCTGGGCTTGGCTTCGTGCAATGGTTCACGGACACGTGTCTGTTCTACAAAGCAGACACTGATGGCGTGGCGGTCGTGAGC
ACGTACGTGGACGGCCTACTAGTGACGGTCACACACGTCGAGCGCATAGACAAGTTCTTCGTGGGCACGCAGTGCCTGGAGCTGAAGAACGTTGGCGTCA
TCGAGATGTTCCTTGACATGTAAGTTCACTGTGACACAACATTGGCCATGAGCAGACGGTTGCTGAGCTACTCGCCGAGCATGGTCTCGAGAACACTTAT
CCAGCGCGTACTCCCATTGGGGGCGAGCCACTGAAACCATAAGGGAACGAAAACCTTCCGCAGGCAAAGAAAGTTGCGAGCAAGCTCTCGACGATTCGAG
AATTTTAAGCTCGTCGCAGTCTGCTGGAGTTTGCCAGATGCACGAGGCCAGACATTGGTGTCGCGATGCACCGAGCGACACGCAGGATACATGCACCACC
TCTCGAGGACTGGGAGTTGGCGAAGGGGATTGCCAGATATTTGAGCGACACAATAGCGTTGAAGCTGATGATGAGCTATGATGACACCGAGCCACTGTCA
CTGCGAATTGTGTGCAACACCAATACGGACACACAGCAGGAGATCAGGTCGGCAGAAATTCGGCGACTGCCGCCATCGTGATGATCAACGGCATGACAGT
GTGATGGCACTGTAAGTAGTAAAGCGCGGTTGCAATTTCCACGGACGAAACGAGTTTGTTGCGGTGGCGCATGGAAGCACAGATGTGCTCGGTTTGAAGG
AAATTTTGCGCAGCTTAGCGTGCACATTAAGTCGCCCATAGCGCTGCCAATTCACAATCAAGCAGCGATCATGCAACGCGAACGAGCCAGATCGGCGAGT
GCCAAGCACGTCAACGTGAAACAATAGTTAATTGCGCGACTACGAGAGCTAGAGAGTTGTGGAGCCGAACTATACTGCTACTGGCGACATGCTGGCGGAC
TTGTTGACGAAGCCGCTGTCTGCGCCTCGGTGCTCGAGCTACGCACCAAGGGCGGACTCAAGTAAGGAGCGAGTTTTACGCCTTCCTATGTTGATATGGG
TACGACTTCTTCCGCTATTCGGGAAGGAGGGTTGGAGGGTGGTGTGTCACTGATGTAGCAGAGCGACGATCGGCAGCAGTCACATTGGATCTTTGAATTG
TGTGGCTAGCGACGTAGATGTGGTGGATGTAACCGGGCGTTCCCGAGTTACTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTTTTGTAAAGTACGCACGAGGTACGCAGTTGGCTCCTGACAGG
ATAGCCAGTGCAAACCTGTGCTAAGTTCGGTCTTAAAGATATTGCCAAAAAAGCTGTGTTAAGTTCGGCCTTAAAGATATTGCACAAACTAGTTTGGAAA
AGTGGTTACTGTGGTGTAACCCACTCGTGTACCCCGTTACAGTGGATGAGCGGCGCGTAGGCGGGAGTCTCTGTGAGCGGGCGCGACTAACAGGAGGATG
TGAGCAGGGGCGACCAGCAAGAGAGTTGCAGGGTTGAGCTCAACTTCAAACACAAAACACATTCTCACTTTCCTTTTTCCTTTTCCTTTCTCTCGCACAC
TCCAAGTTTCGCACTCTTGTTCTTTGTGCGGAAGTTGTAGAAATCTGTATTGTCTTCCTAAGTTCGCATTCGACACACCCCTTCATTGTTTTTTGAGCCA
ACTCACCAACACGAACGTAACGGTGCGTATCTAACGCTGACGAAAACGTACTTTACAACAAGGAAGCGCACCGAAGTACCGTAGAATTCTACGGTACGGA
TTGGATTTGAGAATGATGGTCATTTGTCCAACAATCATACAAATAGCAAGTGAAAACAGGAAACATTTGTGAAACAAATATGCTGGCCTCATGCTGGTCA
GGTCAACAGCCAGCAGGCGAGGAGCTCCATTGCGTTCGCTGGGCTGTCGCTGTCCATCCTGTTGCACTCTCGCCGGCCGCAGGCGAGAGACACATGCGGA
TTGCTTAGAAGGTCCCTCTCTCGGTGCGTGAACGAACGCCGATGAAGTCGGCGAGCGACTGCGCAGCCGCAGCGGCAACCGTTTACCACTTGCGCCCACC
ACCACCAGGCAATCCCCATTCAGCGATGACCAACACGGACGCGAAGATGCAGCTCGCGATCGCCGCCGTCTCGGGCGGCGGCATGTCGGTGCGCGAGGCC
GCGCGCCGCTACGGCGTGCCGCGCACCACACTGCAGCGCAAGCTCTCCAAGGACGCGACCGGCGGTCACAGCGGCTCGCGCAGCAACAGCGTCACGAGTC
CCGGAGCAAGCGGCGGCGGTGCCGGCAGCGACCACAGTCCGAGCCCGACGAGTAGCAACACGGACCACATGACGAGCGCGCGAGTGGCGCCAGCAATGGC
GTCGTCAGCGACGACATCAAACTCGGTCGCAGCAGCGATCTCGAGCGCGATCGACGCAAACCAGAGCACCATGAACACGATCCTCGGGCTCTACGAGAGC
AACGGCAACGGCACGACGCCCGTGGCGTTCAGCAGCTCCATGAGTCGCAAACGGCCCGCCGAGGCCATGAACACACCCGACAAGCAGCAGCCGATCCGCA
AAGGTACACACGCCACCAATGCTTTGTCGTAAGCGCTAGGCTGTTTTTCTGACTCGTGTTCTTATTTAATTTGCGCATTTGAAGGACCACACAAAGCGAT
TAACTGCAAGGTCCGGATGCTCTGCACGTCGGCAGGAAGCGCGCTCGACGAGCTCAGTAATGAGATGATCATGGAGGGCAAGTGCATCTACAAGCTCGGC
CTGGGCCAGTCGCCCTTCCCGATCCCTCAGTGCGTCGTTGACGAGCTCAGGTATGATTTTTTGCTAATTTTTTTTACTGAGCTGCTTGAA