Description :
From Genome Similarity Track
Location :
Scaffold_575:15189- 17027
Transcript NameFunction/comments
Phyta_totarag9379phospholipase D-like protein

Sequence
1838 bases(100 bases per row)
CAAAGTATTATGGCTACCTCATTTATCGACTCCGGTTCAGGAGTAATCATGGTAGTCTTGTACGTGGCGCTGTTGACCCGAAAGTGTGGCAAACTGCCCT
CATTCCGCTTTTAACCGTTTCTAGCGCAACCCAGCACCATGTCAGCGTCGCCATTCGATGACTTGTCCGAAGGATTGAGCCGCGCTTTCCAGTTCATCAT
CGACCCATTccacctgaagaagaagcccgaAAAAGATGCCACCGCGCCATTCGACCAACCTTATCTCGATCCCGTTCGATGGTTTCTCACCGAGGAAGAA
ATGAAGTTATCACGCAATGGTCACGAACGCGAAGGTATCCAACTCTACTCACTAAGCAACCGTGTGAAACTTTATGTCGCCTCCGCCGGCTACTTCAGCG
ACGTGGCCGACGACATGATGGATGTGCGCAGCGGAGATCTCGTGTATCTAACGGGCTGGGGAACCTGCAACGTGCCCTTCAAGCCGCACGAGCCTGACAC
TAAACTGTGCGACCTGGCTAAAGGTGCCGTGAAGCGCGGTGCCGATTGGCGCATGCTCGTCTGGTCAAACCTCACTGAGCGCGCGCAGAACCACGAGGTG
CGCGACCTCATCAAcgcgctgccgccgctggagAAAAACGGTCCCGCACGCTTTGTGTACGACGACCGCCTGCCATTCCCCACGTCATCGCACCACCAGA
AATCCGTGATCGTGCGTAAGGGCCGCGACCTCGTCGCTTACGTGGGCGGCGTGGACCTAACCAACGATCGCTGGGACACGATTGAGCACGACCAAGCCGA
TCTACGCGAGCGCACGGGCATCAAGTGTCTGTGGAACGGCTGGCTGGACGCCCACGCCCGCGTTGAAGGACCCGCCACGAAGGACGTGGCGTGCAACTTT
TTAAACCGCTGGAACTCGGAGCCCAAGCCGTCGCAGGACCTCATTGACGACCTGCTGGACTTCGAGAACCCCGAGTACTCGACGCTGCCGCCTATTGACG
GGAGCGAGATGCCCCTAGATATCCCTGTGGATGGCACTCACGCCGTTCAGCTGTGCCGAACGTTCAGCCCGGATTACGACCACTATGCCTTTGCGCCACA
GGGCGAGCAGTCCATCTTCCACGCGCGCATCAAGGCCATCCGCAACGCGCAGAACTACATCTTCATTCAGGACCAGTACTTCATCCTggtgccggagctg
ctgcaggccatcATGGATATGATGCCCAGCATCGAGCGTCTCATTGTCATCATGCAGCGCACTGTCGAGGCCGAGTACACTGGCTACGCCAAGTATCTGT
ACGACATGGTGTCTCCTATTCAAGAGGCATACTCGGACAAGTTCAAACTATACACCACGAAGGAGGCTCGCCAGCTATACATCCACAGCAAGCTggtgat
cgtggacgacgttTATGTATCGTTGGGCTCGGCCAATTGGAACCGCCGCAGCATGACAAGCGACACGGAGATCGGCATCAACATCGTGGAcacggagctg
gtgcagtcGCCCGACAACATCACGGTGAACAAGCTGGCGCGCAATTTCCGTATCCAGAAATTCATGGAGGCAACCAAGCAGACgtacgacgagctggacg
ccatgaCGTTCCTAGAGGCGTGCGACGCGCTCGAGGCCGCGGCCCACGACGATGGCTCCAGCCTGATCGAGCCGTACGCTGTGGAATTCAAACCCCAGTT
CAATCTTATGTCCGATGGACTGCGCCAGCTTGTTGACCCGGACGTAGTGCCCGACGATGCGCCCTCCAAGATGTTCAAGAGTTTCGTggacaagcacaag
aaaGCCGAGCCGTAGCTCTACTGTaacttgaagtttga