Description :
From Genome Similarity Track
Location :
Scaffold_15:151867- 153556
Transcript NameFunction/comments
Physo_456248Hypothetical protein

Sequence
1689 bases(100 bases per row)
CGCGCGGGGCGTTCCTGGTGGTGAACGCGCTGCTGCTGCTCGTGGTGTTCTACACGTCGCGCCGCTTCCCGCACAAGTTCGTGCGCGTCCAAGGCGAGTA
CGTGAGGCTCCTCGCTATTTGGGGGTCGTTAGACGCATAGTTCTAACGTTTAACTCCTCTGTTACGAGCAGCTGCGACTCCAACTGGCTGCACGTGGACG
CCCCCGAGGGGTCTGAGACCACGTGCTGCAACAATGAGGCGGGGGGCTACGAGGACGCGCCTTGCTACACCGGCATGGACCTCATGCCCGTGCTGGGCTC
GATGCAGGTGAGTCTGTGCAGTTTATGACGGGCGTTCACTGTGCAATATTGACTCTTGGCGTATTGTGTGCTGTGTAGGGAGCGTGGGCCATTCCGCTGT
CGGCTCTGGTGTTCAACTACGGCTCCATGATGCTGGGGCCGAACGTAACCATGCCTCGCGTCCGCGTGTACGTGCGCCGTGGGCTGCTGTACGTAGCGGT
GATGGCGCTGCGCACTGTCGTGTTGTACATGGGCCTGGGGCTGCTGGAGAAGCGGCTCTTTATGGGTCACTCGGACCATGCCTGCTGGTACGCGGATCTA
CGCCGTGGCAAACGCTGTCCCGCTGACTTTGACCACTCGGACCACATCGTGCTGCTCGTCAGCCACTACCTGGCCATTCCGCTGTTCGAGTGGTTCGCAC
TGAGCGTCGAGAGCACTGGACCGACTTTGAAGCGGACATTGTTGCGCGCGTGGTTGGTTCTGGTGGGCGGGTTGGCGACGTACCTGCTCTTCTTCACGGC
GTCATACTTCCACACCACTGCGGAAAATCTCGTGGGATTGATCATTGCGCAGGCATGCGTGATGGCGCCGCTGATGCTGCTCACTCAGGACTACTTCACG
TCGGTCAAGTGGTTGCGCCTCAGCAACTTTGTGCTCCCGCCCGATGACGTCAAGAGGGACAATTGATGATAGAGATTCTCTCTAAGAGAAGGCGTCCAAG
ATTTCGCGCCATGTTGCAGAGCTAGAACAGCAAACGCAATTGTATTCAACGAAGCTTGTTGGTATGACGATGGAGTTGATCGACAGAGTGCTGCCATTAC
CTGAGGAATATCTCGAAATCGTGGACCAAATATACCCACAGTTCATTCAATTGATAGCCAAGATAACGCAGTGCTTGTCCATGCCAGTTTCGTTTTCAAG
AACGTGAAGCGACGCAACGCTGCAACTTTGTAGCGACCAAGAGGCAAGATGGAGCGGCCTGTTGTAGCACCTGTGCGTCGTGTGGCTCTGGAGCTGGCTC
CCGACGACTTGCAGGCCGAGGTATGTACAAATATTTATCTTCTTGGTGGACCTAAAACTAACATACTTCTTCTTCTGGTCCAGTTCGCTAGCTATGGCAT
CACTACTGGCGATGCCAACGCGCGTTTAGCATCCTTGCAAGATAAATACGACGATGAATACGACACCGCTGTGGTCGAATACGAGGCAGCTCTGCACAAA
CTCGAGATGCAGAGGACGAAACAAGCTTACCAGGACGCGTTGAGCACTGCCGTCGCGTTGGAGCGGACTGCTTTAGAACGCGAGCCTAAATCTGCCACAA
TTGTTCACGAAATCGAGACCAACGTGGCGCCCAAGAGACTCGCAGTGCGTGGGATTTCCCCTTTAGCCTGCTGCGCCCTGCTCCGAGCG