Description :
From Genome Similarity Track
Location :
Scaffold_77:151845- 153291
Transcript NameFunction/comments
Sapdi_VS20SDRG_14758hypothetical protein

Sequence
1446 bases(100 bases per row)
GAGACCACGCCCGATAGCGACGTCTCGGCGATTCCCGCCGTCTCGGCGTGCTCACTCATCGGTGCGATCGTCGGCCAGCTCCTCTTTGGCTACATTGGTG
ATGCGCTTGGGCGCCGCAAGGGCATGATTCTGACGCTGACGCTGACCGTCATTGGCGCCATCATGAGCGCCATCTTACCGTACGATGGCTCCGTCTACAC
GATCCTCGCGGCCTGTCGGTTCCTCCTCGGCATCGGCGTCGGTGGTGTCTACCCGCTCTCGGCCGCGTCGGCCGCCGAAGGCAGCTCGGACCCGGTCCTC
AACAACAAGCGCGTCGCCGCAGTCTTTTCGTTCCAAGGCTGGGGCCAGCTCGCGTCGTTCCTCTTGACGTACCTCTTGCTGCAGACAGCGCTCGACCATG
CGATCGTGTGGCGGGTGCTGCTCGGCGCGGGCGCGCTTCCGGGCCTCGTCGTGTTGCATGAAGCGATCGTGTCGAAGGAGACGGGCGCGTACCTGCGCAA
CCAAGCCAACCCGCACAAGATGAGCGTCTGGACTGCGCTCAAGACGTACGAGCGCCAGTTCATTGGCACAGCCCTCGGCTGGTTCCTCTTTGACATTACG
TTTTACGGCAACATCATCTTTACGCCCGTGATCCTCGAGGGCTTGTACGCAGAAGAAGCCTCGACGATGGTGCAGACGATCCAGTTCTCGGTGCTCACGT
CGGCGATCGCGCTGCCAGGGTACTACCTCAGCCTCTACATGATCGGCCGCATGGACTTCAAGCACATCCAGATGCAAGGCTTCGCCATCATGGCCGTCAT
CTTCCTCGTCATGGGCCTCTTCTACCACGCACTCCTCCCGCTCAAGTCGCTCCTCTTTGTCATGTATGCGCTCACGTTCTTCTTCTCCAACTTTGGCCCG
AACGTCAGCACGTTCTCGCTGCCCGCCGAGCTCTTCCCGACCGAAGTCCGCGTCCAGCTCAACGGGATGTCGGCCGCCGCTGGCAAGCTCGGCGCGGCCG
TCGGCGCGTACCTCTACGGCCATATCCAAGTCGCCTACGGCGTGCCCTCAGTGCTCATTGTCTCGGGCTTTGTATCCGTCCTCGGCTTTGCCATCACGTA
CGTTTGCATTCCGTGCAAACAGTACCGATGAGCCATTTGCAGCTAGTCTATACGTATATATATTCTGAATCAAGAAGAGCCTTGGTATCACTGCTGGCGG
CTTGTGGCTATGGAGCGAGGAGCACTAGGCATCGATGGCAGAGGAGCACAGCGCGACTGTGGATGGCTGCGGGGATGGGACCGTGTCAGGACTATGGTGA
CGCCACCATGCAACAAGATGCTGGGTACACTGCGAGACACGCGCTAGTGTCGTAAGCGAGCGAGTAGCTAGGATATAGCACCCATGAGAGTAGTGGACGG
TAGAGCCTCAGTAAAGCTGAAGCAACCTGGCGCCAACTACTGGCGC