Description :
From Genome Similarity Track
Location :
Scaffold_575:15181- 18491
Transcript NameFunction/comments
Phypl_g9527hypothetical protein
Phypl_g9528cleavage induced hypothetical protein

Sequence
3310 bases(100 bases per row)
CATGCAACATCCATTGGGGCCCCCGTGACATGACCTGGACGTCCAGGTGCAGTTGGATTAGAGTCGCTATCACGGGAGCGCTCTCCGTTCTGCCGAGACC
ATTGTAGCTCTTGAGCGCTGAGCcgccaagcaccagctcgtgatACTCCTGCGGCAACGTTGTGAGCTCCGATACACAGGACGGGGGCTCGGCAGGgacc
atggacgacgacacgctgaGTGTTGGGGGATCTCGCGGCAACTCCAGGTCCACGTTCTCTTGTGACGATGGAACAAGGGGGGATGCCGCCACTGCGCTAG
TCTCGTGACTATTAGTCATGACACCTTCCCTGGGACTTACCCGCTGATACGGATCCGTTCGAGGAACAGCTCTGGCCAGGTCGttgtcgtcgagctcctc
gtcgaactcTGCGTCCCAAGGAGAAACAGTGACGTCGCCATAGCCGTCATCCGGAGACTGCTTCCGTCTCGGCATTTGCTTGCGAGACCTGACGGCTTCT
TTGCCAGGTACCGGGAGCCACAGCGGCCTATCACCTTGGCGCGCGTCACCATTGCGTGAATTGGACACGCTCCGTTGAGTGCGAGAGATGATCTCGGCCT
GCAGACTTCCGGTCAAGTACCCTGTCGTTTTGTAGCTGTCGCTCAAGTCTGTGCCCTGACCTGGCCTGCGATGACCTGGCTTGCGATCGTCACTGCGTTG
GCGACGTCCTGTGCTGTGTGCTCCACtctggccacggccaccgtTTTCATCTAGCACAGGCGGCAACAAGCGCTTCGCTGGGGATGCACTTTCGTCGAAA
GTGTAGAACGGCATCGTCGCGTTCACCGGCACCAGCTCTGCCTTGTTGCGAACGCTCGAGGCGAGGCCGCCCTTGGCCCCACGAGTAGCTGGAGCGTTGA
AGCCCAAACCAGAAACAAACTCTCGTGGGGCTCGAGGGCCGGACTGGTTGTCGTCTTGCAGTGATCGATCATTCGAGACTGCCTGAGTGTTCCCTACATC
CTGACCATTTTGCGCCAGTCTTGAAGCCCCAGAGGTGCTGGATGAGTCTACGCCAAGCGCTGCAAGGCGTTTGCTGTTCTTGCTAACCTGGGGTGTGCCC
TCGAAAGCAATGTCAGTTGATTTCTTGTCACCTCTTGGCTTTGCTTTAGAAGAAAGCATTGCCCGTCGTGCACCACCAGAACCAACTGCGGCGGTATCAA
CGCTGCCAAAGGAAGTACCAGCCTTCAGGCCTCCTGTCGTTTTGAGGTGAGATGCTGTGCTGGTCGATAGTCCTCCTGAGGCTAAAAGTCCGTCCGAGTT
GATGCTGCCAGTACCAAGACCCGTCGTCTTTGGGGCGCTAGACGCTGCTGAGAAGAGTTTAGCCGGCTTTTGCTGTCTCTGCTGGGGAAAGTTTGCCATG
GGCAGACCGACGTTGAGAGCCACGTCGCTGTTTGGGATCGTGCTGTTGgccgcagcatcttcgacGACAAGTGGAGTGCGCGGCTGGGCTGATCGCAAGC
GGTTCATGGCCACCAACGTATTAacgccgccatcgtcttctGTGCTAGCTGCGATACCGTTTTCGCGCACGCTAGTCAAGGGCGTTCTCGCTTTCGCGGA
TGTTGTCCGAGATTTTGCGCTCGACCCTCGCAGCCCTgtcggcgtcttcggctCTGTGTCCTTGTCACTGCCTGGGAATCCGCCTAGTGCGCCCAAGTTA
AAGTCTCCGAGCGTGACGACACTCGCCCGCCGCTCTCGTGAGCGTGGTCTGTCTTCTGGGATGGGGTCCGGCGTATTGATGGCGTCCGGGGTGTTCGGAG
GTGGGTCAGGCGATGTCTTGGCACGCACAGTTCGCAAGACTTTGGTCGCAATGAACCCGATCGAGTGGGTGGGAGACGGCAACTGGACTGGCACGttctc
ttcctcttcttcgtcatcgtccgTGTCACCCTCGCTTGGAAattcctcttcctcttcgtcgtctactTCCGACTCTTCTGAAGAGGACTCTTgatcgtcg
tcgatggctTTGATTCGCTTGAGAGACCGTAGCAACCTCCTCCCTTCATCACTTGGATCGCGTTTGTCGCGCCGCATCGTGCTCACTCGCTGCACCAGAC
TCCGCAGGAACACGATGTACTCGTCCGCGTCGATGGTCTCACACCAGAGATCGGCCAGCTCGAATACGCTAtcgaagaaggtggagaaaCTCATGACAGC
TTCGCCTTTGCTATCGCGGACCCAGTCCTCTCGAATTGTTTTCTCCAttcgacgaagacgtcgctTAGTCGCATCGGGCTCCAGACTGCGGCCAATGCGA
CGGAATAACGAGGCGTACCCGCGCTGGTCGATGCACCCCATTGCGTCACGAGGGAGCTCAACAGCCCAAAGCTGCTTGACAGCGTCGATCACGTCTGGGT
GGTTGCGTAGACTGAACCTCAACGCCAGTGCTTCTGGCGTGTAGTTCAGCAGTTCTTGGGCCTCATGCTCACTGCGAGCTCGACTGTACAAGTCCTCGGT
CAGGAGCACTGGACCATCCTCCCAATTTTTGAGTAATCCTCTTgccttcagcagcgcttcctctTGCAGGTGTTGGTACTTCTGTcgcttgagcgtctgc
agccgCGCAGCTTTGATGGTGAAGTTGAGCTTGAGCCATAGCACACTCGAGGATCTCTGCTTCCAGTTTCCCTGTCGTTGAACTGTAGGCTCCGTCTCTA
CGGCTGGGGTCTTTGCTCGACGACCAGCCGAGTTCTTTGGGCGCTTTTTGTCCATTTGATCACGAGTACAaaccacagcaacaagcgTCCTAGCGACATT
CCGCTATAAATATTGAACGAGACGAGGATGAAAGATAGATGAACCTGCATATTACTAGTTGAAGTAGAATTTAGAcccttcttgtcctgctACATGGTAG
AGTTTGATCAGGAATGTGCATTTACCGGAAGGAACTAATGTAGGGCCTTGCTTGTTCCTCAACTGACCTTACTGGACaaaggagaaggcgctgagcTTGC
CGCTGTCCAAcctcgagctggacgaggtgatcgacGACTGCCGGACCATTCCACCAGCTTGCACCGGAATGCCGTAGACCCACGAGCTCCTGATCTCCGT
GGGAGCTGCAGTTGGCTGGAGCTTCTGGAAGGGCATGAggttctcgtcctcgaggtCGTCCTTGGTCACGCTGCTACGGCGTCTCCATGACGCCTGGATG
GCTTGGGACACCTTCGGGCTCATAACTAGTGACGGTCTCGGATGCTGAACTAGCAGTGCGGTGCTCTTGGACATGGTGGGCTCCGGCTTAAAGACCCGGT
TCACCGCCAA