Description :
From Genome Similarity Track
Location :
contig_5:151809- 153085
Transcript NameFunction/comments
g1315.t1hypothetical protein

Sequence
1276 bases(100 bases per row)
TATCAGCACCTCCACTTCGAATCTGCATGTTTCGCTCCACGGTGGTGTCGCCTTGTTTTCACACCGATTCTGCCTGGAGTACGCGGCTCGCCAAACATCG
TCCAGTGTTGTTGATCCTCTCCCTCAACCCACAGAAGGTCATAGTCCATTGAATCCTGGGCTGTGATTGCTGCAAGTAGTGAGGTCAAACCACAGAAACC
GCTCAGTATCGTCGATGCACTCTCAAAAATGGACCAGAATGGTTTGAAAGACGATGCGCTGGCAACTCGACTTCGAGTAAGGAGACAGATTTACTTGCGT
TGGAATCCTCTTCATCTTCGTCTTCGCTATCCAAGCCCAGCCCAGCTGATATCACCTGCTGCAAAGTTGCAAAGAGTGTATCGCACTCGCCGAACGTTTT
GCGTGGTTTGTGTGGAGACAATTCCCGCTTTGCATTATCTTCGCGAGCATCGACATCACTCTCCAATTCATCGGAGGTATCTGATACGCTGTCTTCTTCG
GAGATATTGGTCGAGGATCCAGCTGAATAAATGCCTCTGTCCACAGCAATGAACCCTGGAGATACCGACGCGACCCCACCATTACGGCGAAGCTGAACGC
TGTTACCTCTTGGCTCAGGCTGGTCGCTATGCTCCTCCGAATCACTTTTGCTGTCTCTTCTGTTGGACACTCGTATTTGGACTACTCTTTTCTTCTCCCC
TTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGCTTCGTCCACGCGGCGCCTT
TTCCTCTGCATTTCCTCCGGGGAAATAGTCTTGGACGTGGCACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGATTTGACGCTCGAGTTCCCCCC
TGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGCCCTCTTGTTGATCACGTGGAG
GGCTCTGAGAATCTTGAACCAATCGAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAGCTCCCTCACACCCACGTCTGGA
GCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCCGCTGTAGCGGGCCACACAGCCA
CACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCAT