Description :
From Genome Similarity Track
Location :
Scaffold_452:15180- 18547
Transcript NameFunction/comments
Phypl_g8476conserved hypothetical protein
Phypl_g8477conserved hypothetical protein

Sequence
3367 bases(100 bases per row)
TGCGGTATGAcgtagtgctgctgccgggaACGGGGGAGCACGGGTTTCTGCATCGGAGGACGTCCATTGCCATCCCACTGGCGAAGCAAGGAGTTGCCAC
ATTGGTACGTTGTTTGTGAAACTTCTACTGCATTGAGCATTTGGAGTCCTTGACCATTCCGTACGTATATATTCCTGTTGGTGCAGATTCTGGAAGGACC
TTTCTACGGAAAGCGCAAACCACCTCAGCAAAAAGGATCCAAGCTCCGAAGGTATGGCCTGACAAATTATTCCATTGGcattgtacatgtatgccGGGTA
TTCAATAGTGTTGTGTGTCATAGGGTAAGCGATTTGCCGATCCTAGGGCAAGCAACAatcgaggaggccaagtcACTATTGGAGCACTTCCGCGATTGCC
ATGGCTTTTCGCAGCTGGTGGTCGCAGGTAGCAGCATGGGCGGCCTGCATGCTGCTATGGTTGCGTCAGTGTTTCCTGGAGATGTGGGTGCTACGGCCTG
GCTCGCGCCACCCTCTGCCGTACCCGTGTTTGCCGATGGATTACTGTCAGGGTCCTGCAACTGGCGTTCGCTGTACAAGCGGCACGAGCTTCAGATGCTG
GACAAAATGCTCGCTGGGCGCGCTGTAGCCGAATCGTACGAAAAACTGGCGGATGCCCTAGCTGACGTGGAGAaagagcgagctgaagcttcCGAAGATG
AGCTTGACCCAGTCCAGgaagccaagaagcgcatgaGGTTATTCCTCTCGATTACAGACATCGATAATTTTATGCCTCCCCGACGATCGGATGCCGTGGT
TTTCGTCTACGGTACTGAAGATGAGTACATTGGCTTCGCGGAGCCCCAGTGGCAGGTACGTTTCTCTGCGTTTAGACGTGTATTTGGGCGTAAAGTATCT
TACTTTCGCATTCTGTCTCGTTTTATCTTCCTTTTAGCGCATGCGTGAACAGTGGAGGCCGGCTCATTTTAGGACGATCAAGACTGGCCACGTCACCGGG
ATTTTGCTGGAGCAAGAAGCCTACCGCAAGACGATTTTGGAGGTTGTCGATCTCTTGAAGGAGCGACGTGTAGTTGCGGAGTCCTTGTCtaaagctgctg
ctacctCAACGTGAAGTGCTCTTTGAAGGCAACTTAATATTTGCACGCTTCCGTGCATGACCTCCTGCGGCTGACCGACAAGTGATCGACGCGAGCTAGG
TTAAAGCTTGCAGCATCAATGCACACTTACACATTCCTGTTTGTCGTGCGTACGCATCTTGGCATTGACTCGATCACTCGTGGAGGCAGCAGACGATGAT
ATCCTGGTACGTGCTCATGACggtgcgcagctcgccgcgGGAGAGATTCTCTCGCCACATGATCTCTTCGATGTGGTGCTCCCCGTGGAAATAAACGCAT
AGCCGCTTGAAAAGCGTGAAGACTGGGTTGGGTTTGGCAATCTTGGCCAGGTACGCACGCTCCTGGTCTGTGAACAATAATTGGCTAGCCACACTCACCA
CTTGTGCCATTGGTACGGTGCTGCCTGTGCGTGTGTCTGCAGCAGGattctcgtccagcggcgctggcgagggCGACGGTGCCGAGGCCGCTGGATTCAT
AGGCGGTGTCTGTGCGATCGGCAAACTACCCGGCGCACTGGTGTTGGTAGTGCTGCTGTTTAGTCGTTGGCGATGGAAGCTAGACGTCATTAAAGCAGGA
GAGGAGCTGCTAACCGATGATGCGCCTCCATTACCAAGTTCGACTGCGTAGTCTCCATCGGATGGGATCATAAAATAGATGTAGCGGTGAAGCTGCATAA
CAAAtcgttgctgaagcagccAGATTAGCATATGGATGTACTCAGTTTTCTTGGCGGTGGACAACGTCTTCATGTACTCGCCAATACGACGAGACCCGGA
GAATGTTGACAAAACCTCGCCCAGCTCATAAGGCGCGAACTTACGTCGGAACTCGAGCGCAAGAGGTGACGTGACGTGCAGATCTGCCTTCGCATTGACC
TGATAAATGTTATACAGGGTGATGGCGTCCACAATGCGGCCGAATCCCCAGTAAACAAGATGTGCTGCCAGTCGGAAAACCTGGTGAATTGGCGCACCAG
TGTCGAGCGCAATATCCTGGAAGCTCTTGAGCGGATTCACAGCCTCCACAAGATCTCGTAGTTGTCGTGCATGGTCAGCAGGCAGCTTATTGAGGATAGC
ATCCTTGTCCGTGAGAAGCTGAAGTGTGTGGTACGGTCGTAAGCTTGCCATTCTCACCGTCACAGCGTCCGTCAGTGTCAGCGACAATTTCACCCAACCA
TTAAGCACCACATGAGCGGCTCCAGACTCCTCCAGCCCATAAAATACCCGTTTCAGGTCATTCGCCAACACACTCTTCCCCAACGACACGTCAATCAGCG
TCTGCGGATCCACCTCCACCGTCGACGATCCATTCTCCCCGTCCTTCCTGTGATGATGGTGAAGCATCAAACTGGATCCACTGGTAGCGACACCCCCTCC
GGCATTGCTCGtaatgctgctgccactcgtCGCACCCGCTGCAACCGCCGCACTCACACTATTCCCACTGGAATTGTCGTTCCCCGCATTCCGCTCGCTC
TGTGCCAGTTCGTCtctcaactgcagcagctccctcACCTCTTTGGACACGAAACCCAcgcggagctcctcgtgcaaAAGTCCGTTGGacagctgcgccg
ccactgTGTGAAAAGCTTGAGCGCTGCTCCGTCGTCTGGCCAAAAGTTCCTCCTCAtcggcctgctgcagggGCAAAAACTGGGTATCGATAGACCCGCC
CATGacttcagcagctcttgACACTTGTGGAGGACGGTCTTCTAGGGCGAAAATGACGTTGAACATGGTCGTCTCGTTCCCCGTTGTGCCACTGGAACCG
TTGGTCGATTGCTCTACAACTGTAGTGGTTGCTCCTGCAGCCGATGTAGATCCGTTCGTGGCCGCAGAACCGCCCCCAGGGCCGTCCgcgggtgctgcag
ctggcagCCGACGCGAAACAAGCACTGGGTGGCTCACGAAGCGCAGAtcgtccaccacgagctcgaaaCTGGCGTTGCAGAGCGCGTTCTTGGGGCGGAA
GAGCTTGGCCAATAGAGGCGCGGGAAGCGTGTGGAAGCTGGACGCGTTCTCGCTGGGAGGGGCAGGGTAGCGGAAGGCCAGGTTGCAGCCCTTGCTGAtg
tcgtccaccacgagcgcgaCGCCCAGGAGGCGGCACCCTCCGGCGAGTTGGACGCCTGCGCTGGCGTTCATGGGCGGATATCACAATAGCGGAGGTAGAA
TATTTGGATAGAGAGGTATGTGCTCGCAAAGTGTAGGTGGGAGGCAACTTTTGAGTTTTGCTGTGTG