Description :
From Genome Similarity Track
Location :
Scaffold_333:15180- 16301
Transcript NameFunction/comments
Albla_Nc14120800putative Ptype ATPase
Albla_Nc14120770putative Ptype ATPase
Albla_Nc14120750putative Ptype ATPase

Sequence
1121 bases(100 bases per row)
GGCTGGGATACAATACGAGATTGACATGATACGTGAAATACGGATGATCCCATCTTCTCTTGATGGCAAAAGCGGACTCTTTTCAGGGTCAAATGGCTCT
AAAAACACCAACGGGCGGCATGGAAGCTCTGCAGGAGGTGGATCTGGTTCTTTTCGTGGTGCTAGTGGAACAGGCGGAGGAGCTGGAGGAGGCTCCAAAG
TCAAAAATGGAGCGAGTCGTCTATATTCCTCTAAACAAATCCAGAAGCTTGAAGAATGGTATCAAAAGTCATCACGACCAGAAGCAAGTGAAATACAAGC
AATGTATCGTATCATCAATAGCGCGGAGTATGCTGATCGCGAATTACAACCGGATGGTATTTCGGTGAAGCAAATCCGAATTTGGTTTGATAATCGGCGT
GCCAAGGAACGCCTAGACTATATGCGACTCAAAATGAAGGACATTTCCACAGCAGATATGGATGCCGAAAGCGTCAAAAAGATGAAAGCAGCATACATAG
ATGAAGCTAAAGAGGTCTTAGAGGCTCGCGTTTCGCGATTGCGTGAAAATGGCAAAAGTGCGACTCAAATTGTAGATGAAGCCGATCTACTGCTTATAGC
GAGTGGTGAGCAGCCACTCACTGCTAAACCTCCGCGATCAAGTCAAATCAGCGCTAAAGCTTCAGCGAATCAAAATTCCTCCTTGGGGGGTGGGCATAAA
AGTAGCATAGTGGAGCAGAAGCCCCCACCAAGTCTGAAAAAGAGGATTCGAATGGAATCTGTTGCATCGGTGCGCAAAGCGGTCAAAGAGGCAAGGGATG
CGGGGAAGACAGAGGAAGAGATCAGATCTATTCGTACCACAGCGATAGACGTAGCAAGACAACGCTTGCATATACCGTACAAGAATGCCCGCGTGGGTCC
TTCCAGACCACTGGGGAAAAACGAAGTCACTCACATCAAATTCAAAATGCTCAAGCTCTTGGAAGAAGGTGCACCACCAGAGGATGTGACCGATATTATT
GAATTACTTTTATCTGTTGTCATTCCTCGCCAAGTTTTGCTCGACTCTGGATTGACGAGGCAGCTGGAATTGGCACAGAAAGCGCATCGAGAGAACAAAG
AGCTAGTGAAGCAAACCAAGA