Description :
From Genome Similarity Track
Location :
Scaffold_997:1518- 3623
Transcript NameFunction/comments
Phyta_totarag11692hypothetical protein
Phyta_totarag11693hypothetical protein

Sequence
2105 bases(100 bases per row)
CTACATTCTCACACAATATTTCTCAGGCACTATATTCACGATCCCACCACGATAGAGCTGCGCACATCAAGAACATAGCCCTACCTATAGGTTCGCGCGT
GCGTACATaatgtcaaaatgcaaacatTTGCTGTCAACCGTTCTACATTAACCCTATCGCGGTGGAAGGGCGAATGATGCGCCCGTTAAGCTTATTCCTC
GATCTCACCTACCATGTTTTGTTACCACCAATCATAATGTTCATTTGAAAGGCTGGGTGTAATTTTGGGCGAGATGCGGTTATTTACTGCGCCGAAGCCA
TAATCCGTGACCATAAAACTGTTTTTGAATCCAGAGCGTGTACCGAAACGGGCCTACACTGCTTTCTATCTGCCTTTCCTGCTAGCCGTTCTTACGAATC
AAAATCTAAGACGCATGCAGTTCTATCGATACGCCCGttactggagcagcaatgAGAACAGACTGCAAAGACTAGGAAGACAGAAAGCTAGTGCAGATAG
CGTTCTAGTTCGAGAGCGAGCGCCTGCGCATCATGTGAGACTATTTAGCGCGGCGAATGCAATCTCAGCGCActgcgctccagctccgattGAGAATGGC
CTGCCTCAAGAGAGCGTACGGCAGGTTCATCGGCGATTTCTCTCCTTGTTTCTTCGTAGGCTTCTCGCATTGCCGTCTATTAACAGCATTGGGGCCTCCA
CCCCCTCCTCCTATCATTTCATCGGCCCAACATCCGAATACCTTATCATTAGCAAGTGAACAACCCGGAGAACAATGGGGACGCGGAGGCCGAGGTGGAC
GTGGCAcccgtgctgctgaacgTGCGGATGGCGAGGCTGCGGTGACAGGTACAGTGGTGCTAGCGTCCTCATGATGCAGGCTAGGCAGACTGACTAACGG
ATCGTgtgcttggtggtggcgttgcaGGTGGTGAACATGACGTTGGTGGGGCCTGTGACGTCCGTGGATCTGCTTTACATGAATAACGACATGTACGACA
GTCTCTGCTCACCGCGCATGAAGCGGCGCTGGCTATCGCTTCGATCTTGGATGCAGTTAGCGGCCGTGCTCACGACAATGCTGGAGAGATCCTACCGCCG
GGAGCGGCTGCGCTGATCGACGCAATTGGTCCGGTGGGAGATGATGATATTTTTCTTGATGTTGGGGCTGGTATCGGCAACGTGCTAGCTCAAGTTGCGC
TTACGACAAATGTCAGTGCCAGCGTTGGCATCGACCTTCGATCTGAACTATCCTCGCTGGGACAATCATGTATTCAACGACATGTCGAGCATCTTCCGCG
CCTTACCAAGGTAATGCTTAAGGCGGCAGATGCTATAGATACTGCTATTTCTTCTTAGTCACCAATGTGCGATGCAACTATAGTGTTTGCCAACATCTTT
CTtttcgaagaagatgcaaaGCTAGTTTTTTTTTCCGAGAGCTCAGCGCAATGGCACGGGCCAGAATAAtcgcagcaacatcacgcTTTTGCACAAGGCA
TCGCGCATCGTGCTCAGAGCCTTTTTCCTATCGCTGGAAGTTGGTGAGTGAAGTGAAGGTGCTGTGTAGCCGGAAGTCATCTCTTCATTCGATTTACACC
TACCACAAACAAAAATAATAATGAGTGCGATCTATTCATCAGTTCTATATTGGTCTGCTGAAGTCCTTTTACACCACACGCAGGCACGCGCCAATCGATG
AGCCCCGCCTGTGTTGTGGGAGCGACCACGGCCTGCATCATGTACCCAAGTAGCGCCAACCCCATAGCGGGGTCTGTGGCGCAGCCGTGGCCACATCCTT
CACCGAATCCGTGCGCGGCGTCACCTCCTCGgctctgctctgctccatGTACGCGTCTTCCGCCAGGTCCCTGagcgccgcctccaccaaGTCCGTTGGC
GGGCTACGTCTGGCCGTGGAGGTTCACGGCTAGGTTCTGAAGCAGCCTCCTGGCGTAGCTTAGCGAGCTTTGAATGGCGGCGCACGTTCCCTTTGTCTGT
AAAAAGTTGACTTGGCTGGTAAAATTGATGAAACTTCTCCCAGCACGTCAAAGTGACAGAAGGGCACAGCCAGGGTTGGGCGGGCTGGCCGTGCATTACT
CGGCA