Description :
From Genome Similarity Track
Location :
Scaffold_289:1518- 3320
Transcript NameFunction/comments
g11709.t1hypothetical protein
g11710.t1hypothetical protein

Sequence
1802 bases(100 bases per row)
TTCGTAAGAGTTCTCTGCATCCTCCAAACCTTGCCACGATACCTCCAATTCCCAGCGCGACAGCTCGTCATTGTAGCGCGCGCCGCAGAATCGCTCGACG
TTGAGGAGAAGCCCTTGGTTGGAGACGTGCTGCATCATTTCCTCAGTGACATCGAGGCTTGAGTCGGCGTAGAATTTCAAACGAGAACCGTGTACATCAT
CGCGGGCTTTGGTGATGAGGTGTTCAATGATGAACGAATGCGAGAGGGCATCAATCACCTTGAAAGGTCCGACCCAACGGACCATGCGTTTGTTCCCTGG
TAGTCGATCATCCACCCGAGACCATAAATCAAAATCTCCTTCCGAAAAGTTGCATGGGCCCCTTTCTTCGCTGCCATTTGCTGTAGTCGACGGCGCTCTC
GAATGTCCGCAACCTCTTTATGCATCTCCTGGAGGCTGCGGCGTAGCTCATCAAGTCACTTCACAATGGCCGGCTTGCTCAGATCGACCGCAATCGGTTC
GTCGTCGTGGCTACGATGCGGATTCCAAATCACATCCAGTGCGCTAGATGGTGGCAACCCCGTGAAAAGCTCCACAGGAGCCGTGTCACCCAATGATGGT
AGCTCCGTGTGGTTTAAATTAGCTTGGACTACCGGAAGCAAATATGGCCACTCCTTGGTGTCCAGCTGATACTCCATAAGGAGCACTCTGAGGACCTGCA
GGACATCGCGGTTCACTTGCTCAACAGTGCCGTTGACCCACGGACAGTACGGTGGCGTGAAGTCCTGCTTGCTTTTCAACCGGCTGCTAAGCAGATTTAA
CACCGAGTTGCGAAAATGGGTGCCACAGTCAGACTGCCAGGTCTCCAGAGATCCGAATCGCTTATACCAGTCCATGATGGCTTCAGCGGCTATGAACACA
GTCGGGGAGCTGCAAGCGACAAGCTCGCAGAAATGCGTCAAATCATCCTTCAATACGAGTCCGTTGCGCAGGTCCCCATGACTCGGAGTCAACGACAAAA
AGTCCCAGTGCAAAACTTCATTGCGTCTGCTGCACTTTAGCGTAGGTCCCCACGGGCGCTGAATCACATGCGGTCCCTTCACGTGCTTGCACAATAGACA
CGTTCTCACAAATCGCTTGATAATACCAGTAATGCAAAGCGACTCATTGTATTCAGCATTGCCTGCTCTCCTCGATGTCCTTGGGATCCAGCATGGGCTA
CAACCAATATGCGACCCAGCAAACGCTTCGCTGCGACAGGAATCCACGGCTTGCCGTCAACACACACCAAACCATCCACCATTGTGTGGTCAGGTGGTGC
TGATCGTACATGCCTCTGCTGAGCGTCAGCAAGACTTTCATTTGAAGGCCAATCAAACGCGCCGTCCTCCAATGGTCGAAGCTGCGAGACTTCCTGCGCG
CTGCGGGTACGCATAAAGTTAATCTTCTTCACAGACTGACTGCCGTCCCGCACATACCACCATCTCGACACGATGTCCGCCCATAGGTTATTCGCTCCGG
GAATATGCTCGATTGTGTAGATGTACCCAGTTAGGCACATGGCCCAACCCTGCAGCTTCGCTGTGACATGCTTCTTGAGCTCTTTGTCCGGGGCAAAAAT
CGCGAGCAGGTTCGCATGGTCACAGTATAACCGAAAACCATTTGCACGCTGCAGTAAATACTCCAGCGTAGTGCACGCTCGGACGATCGGAAACGCTTCC
TTTTCAACGATACTCCAGTTGGCCTGCGAGTCGCGAAACATTCCCCCTTTGCACACCAGCAACTGATGCTGTTGCTCATGGATGGGCAAGTCGTTCTTCC
AG