Description :
From Genome Similarity Track
Location :
Scaffold_2006:1518- 3288
Sequence
1770 bases(100 bases per row)
AAACTGAAGTTGGTCAGGAAATATCCGGACCGGCCGCAAACCCGTCTTTCGGTGGATGAATCCGACCGGGAGGATTTCGACGAAGTACTCCTACCTGAAG
ATAGTTGGAAGGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAAGGAAGCGAACTAGGTACGGACGGATTTACCGTGA
ATTTCTGGTGTACTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGACAGATCTGAACTATGGAGCATTACTCTATGATTCTTGCGGGATCGTACGA
ATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGAGGAGCCATGGGTGTGAGTCGGTCATGTCGATGGGAGTATGAAAAAGGACCC
CCAGGAAGGGTGTGGGTCAGGAGGAGGAGGATCACTGGTGTGAGCTGGTCATATTGGAAAGAAAGAGAAGAAGAATCCACAGGAAGGGGTGGATCAGGAT
GAAGAGGTGAATGTTTATGCATAATGAGTGACGCTTTACGTGCAAAGAGTCCCAAACCAAACGCGAGTTTTTCGGGGCTCGGATCATACTGGTCTAACTG
AGACTCGGTCGTAAGAAGTGTATTCGGCCCAAGTCCGAGCGCGGATCCAACCCGGATCCCGAAATTGTAACGGATCCAGGTGTATGCTGAAAGGGTGGAT
CCAGCCCAGATCCAGGCGTACCCTGAAAGGGTGGATCCAGCCCAGATCCAGGCGTACGCTGAAAGGGTGGATCCAGCTCAGACCCAGGCGGACGCTGAAA
GGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAAAGTGTATCCGGCCCGGATCAGGTGTACGTCGGAGGGCTCTGACATAGCTTCTCAATCAACAAG
AGAATGTTAAAGACATATTCAGGTAGAATGTTAAAGACATATTCAAGTAACGAAGAGTGAATTATGATAGCTTATGTAAAAAGGCTAGCTCGACTCAGCT
TCCAGCCGCTACTTACTACTACGAAGCGGATCCACGAGGACTGGAACTGGGGGCGCAGCGGGAAAGAGCGGTATGGATCAGGTGGTGTGGGGGCTGAACG
TTGAAGAACTTGCCCGCCAAACGCTGGATCCGGTGTCCTGGATGTTGGCTGGGGTTCCCCCGAAATTGGGTGCGCCAAGGCTCGACTTCGTCAATCTCTT
ACAGAGCCGCCACTAAGCTCCTAGGTTCCGGGCGGTGGAGGCTGGGATTTCCCAAGTTGGCTTGACGAGATACGGATCCCGGAAACCACGTTACCTTATC
CCCGCGTCGAGGAAGGTGCAAGAAGGATGGATCCAACAAGATATACACGTCACACCAACCGTCTTGGATCGCTAGCACGAAGATCACGGAAACCTTCTTC
CAAGCCCGACCGGCGTGACTGCTTCTGTTACCGCGCTGCTTGTTGAAGTTCGACAGCCATGTCAAACTCCGCAGTCGGGCACGAGAGACAGGGAACCGAT
GGGAGCCTTCCCATATGGCAATTCGGTGTTTGGAAACGAAATCTCGGAAGGCACCAACGAACAGCCCGAGACGTCCACCGACGTCACCTCGGAAGCTAAC
AGGATCCACCAGCGTGGTCGTCAAAATATTCCATGGTGCGGTATTATGTAACTCTTCCACGTGAGATCTGGTGACGAGCGAATCCACATATCCGGACGTC
GGCATGTCATCCTCTTCGCGAGGGAATATCCACTCAGTACGGAATTGCAGCTCAGGGAATAGGACGGTGA