Description :
From Genome Similarity Track
Location :
Scaffold_1:151794- 154596
Transcript NameFunction/comments
g38.t1KUF91590.1 Leucine-rich repeat-containing protein 45 [Phytophthora nicotianae

Sequence
2802 bases(100 bases per row)
GTGTGCTTTCATCCACGTGTAGTATAAGTGGCGTGCGTGTTGCAAACCAAGTGCCCGTTGCAACTTCAAATTCATTCGTGGCGCCCATGTTTGAAGGGCT
TTCGCCTGTCCTAGTAGTTTTCAGGCATCGACAACGCTCGGCTAGTACTAGAGGGACTTAACTTCTGGCGTTGCTACATTTTGATGACCAGGACCAATCG
ACTGCAACCCAAATCGACTGAGTTGGAAGCGTCTGGGTAAGCTCCACACATATTTAGCTGCCAACCACGTGGGGATATCAGTACATGTTCGAGCTGTGCA
ATATGTTAAGCCGTCCGTTGTTTGATCAGTCGTTTTGCAGCAACCGGCTGCATGGTGAAGTTTTTACCACGCTGACTCCAGCTTCTGACTAGAGCAGTGT
CGGCCATACGCACTACAGAGACAAGCGTGTCCTCAGTAACGAGCAGCTTCATGTACAGGTTGAACAGGCTCCGGATCTAAAAGATCGCGGGTGCTTTGAA
CGAAACGACTCTTGTCACAAGCATGACGATCCCAGCGAAGCGCGAGTGTCTCGTCGAGGATTCGGAGGCTGTAGCCCTTGTGCACCTCAAACAGCCCGTT
GACGCAGTGCTCGACTACAGCAACTCGTACTTGGGAGACGACAAGTTCACGGAGATTGTCGAGAAGGCTCGGCTTGCGAGCGTTCCGACTCGATTGGATC
TGAGAGGGAATTGCTTCGAAGCTGGGGCTGCCCGAGCGCTTGCGGCGCTGCTTCGTTCGTCGCACAATGTGGTGGCCATCAGTCTGGAGTGGAATAATGT
TGGCTTGCTGGATCAGGGGGTGGAAGCTCTCGCCGGTGCGCTGGAGGTCGATAAACGGTTGCTAACGCTCGACTTGCGCAACAACAACATTGGGCCCGAG
GGTGCCAAGGCGCTGGCAAAAGCTTTGAGAGTTAACCGCTCACTACGTCAACTGGACTTGCGTTGGAATGAGGTCGGAAACCCAGGCGTGCTCTCATTTC
GTGAGGCATTGCAGAGCAACCACTCGCTCGTGACACTGGAGCTCATGGGGAACAATAGCAGCTTAAAGCACGTGGACGAAATTGAGGAGTTGTTGACAAG
GAATCGAGCGCTCTCGGGAAGACAGCCACCTTTGGCCGTAGATGCGTCGTGCCAACCCGATGAAGATGTCGAATCCAACAATTCGATCCATAAAGCTGCT
CGGGATGACCAACTGCTACTACAAGTTCTGGCGGAGAAAGAAGAGCTCGAGCTAGAGAGGAATCTAGGCAAGCGAGAACTGCAGAAAATGGTAAGATATG
GTGCACATACTACGAAGTATTTGTTACTATTAGATGGCGAGGGCTAATGATGAGCTTTGTTGCCATTCAGGTGGAGACGACGGAAGAGCTCGAGGCGCAG
CTGCAGCAGGTCCGCAAAGACGCTGAAATGACCAAAGAAGAACGGGATCGGTATCAACAGCGTGAGATCGATGCAAAGCGCGACGTCCATGAACTGCGAA
TGCAGCTCGATGAACTCGAGAACCGAAGAAAGCTAGAGTTCGAAGAGTACCGGGCCGCACGCACTGCTCTCGAGCGCGAAAATGGCGTTGTGCGCGAGAA
AATGGGGCACATGGAGACGTTGCGAAGCAAGGAGACGGAGCAGAAAGACAAGCAGATCTCGCAGCTGGAAGAGGTCAAGTATGCTCTCGACAACGAAGTA
CATCGCTCAACACTCACACTAAGGTAGGCGACTCATTGCTTTTAGTAATGGAAATGGTCGTGCTAAGTTACTAAAATGCTGTGCAGAACGCAAGCAGAAG
AAATCGGTAAGCTGCAGAAGCAGCTCCAAGATGCCCAACAAGAGTATGGCCGCAAAGAAGCCAAGCTCGTGTCGGGTCACGAAGGCAGTATGAGCGCAGC
ACAGCGGCAGCACGACATGATCGTTGGCTCTGTGCAGACGCAGCTTAGTTACACCTCCACTCAGCTAGAAGCAAGTGAACGCAGTGTGCACGAACTCAAA
GAGAAGTGTGAGGCTCTGCAGGCCAAGCTTTTGCAGTCGCAAATTGGCCACGAAAAGACAGTCGGAGAGCTGAAGCAGCAATGGGAGGCGGAGCTGCAGG
AGCGCATCCAACGCTCTGTTGGATCGGTGGAGGCCCAAGTCGCCGAGGTGAAGAAGGCGCGGCAGCACCTCGAGCGAGAAGTGGAAAAACACCTTGAGAC
CATCATCCAGCTCCGACAAGACAACGTCTCGCTGCAGCAAGCCCGAGATGAAAAGCAGAGCGAGTTCGAGGCCGCGACGGAGACGCAATCCAGGGCGTTG
CAGGAGAAGCAGGCGCAGCTAGCCGCAGTGACGAGCGAGAGAGCTCGGTGCGAGGAGAAGTTGCAGCAGCAGGTCCGGAGGCTAGAAGAGCAGGACGCCA
GACTCGTGCAGATGCACGCAACCTTCGACGAACGGATCCATGTACGTTCGCTAGCTGTCTGTCAGAGCCTCCTGCCCAGCATACTGATGCGTTGCTGTGT
TTTTTTGCAGGCTCTGAATGCCAGCGCAAAGATCGCGGCGGTGGAGAGCGCCACCATCTTGAAGGAGAAGGCGGGGGCGATCGCGGTGCTCGAAGGCCAC
GTGCTGCGGCTGGAGCGCGAGCTGTCGGCGCAGAACCACGAGCACGAGAAGCGCATCGACGACCTGGCCGAATCCTTTGGCCGTTTCGTGCAGGAGCAAA
TCGCAAAGGAGCGAGAACGCCGCAAGAAACGGTCTTCCGACGCGCTGAGGTCCGACGCCTAGCCTGTTTGCCGGCAAAGAGGCGCGGCGGCACCGGAGCA
AT