Description :
From Genome Similarity Track
Location :
Scaffold_688:15179- 16491
Transcript NameFunction/comments
Phyag_g7500hypothetical protein

Sequence
1312 bases(100 bases per row)
gcgacgatgaagcacaCGCGGTAGCCGTAATTGCCAACGATGATCCCGCCGAGCACGGTGCTACCTGCTAAGGAGGCAGCCGTCACCCCATCTAATGAAT
TCCAACGCGCACGATGTGACTTGGGCACGAAATCCATGAGAATTGATCGACGCAGGGGGTCTGTACACTGCATGAGTGCTCCATGAGCTACGAACAGCAC
GCAGTGGTTTACCTCGTCGCGTGAGACGGCCGTCAGCAACAAGCTAATCGTGCCAACTACGCGTGTAATTACTACCACGGGCATTCTACCAGTGCCATTT
GATGACATTTGCGATAGGAACGAAAGCAGCGCCATCACCAGCGGCTGTAACGCAAAGAGAGTTTGCATCCGCACAGGTGAAAGCTGATACTCTTGCGCGA
AGAGCAGCGGGAAGACAGCGGCGACTAACCCGGTGCCGTTGCTCACGAGGAAACCCGACACAAACAACAAGTACGGCACGTGAACTGAACTTAGCAACCC
CCAACATGACATCCTGGAGTGTGCAGGAACACTACCACCATCGTGGTCATCTAGTGGGGCAGCTTGATAGTATCCTGAAGGCACTCTTGATGTCCGCAGA
AGTTGAGAAAACTCGTTTGTCGACGATATCTGCACACAAGAGAagcttcctcctcgttctGAGGCAGAACTCTCTCTATCGGTATATTCGGTGGTGAAGT
TGCGCTCGATCGAACTCAATTCGCGCTCGATAGCCAGCACATACTGCCGGTTTTCGAATGCCAGGTCGTCGTTGAActgaaacagcagcagcatggacAT
TGCTGCGAGAAACAACCCAAACATCAGGACAGGTCGCAACGCTGCAAGCGACCAGGAATCTCCATATTTCCACAGCAACATAATGGCAGTTGACGGTCCG
AGTACAAGCGCAATGCTGCGCATGATGAATTTCAGCGTGAACGGTCTTGATCGTTGCCCCATAGGCACGGAATCAGCAAACAGTGCCTCCAATGCAGAAC
TCTGGAAGGCGGTGAAGGCCCCCCACAGTCCAAACGCAACGTAAACGAGGAGCATGTCCCCCAATTCGAACGCCAACGCTGTTAACGCCGAAGCCACGAT
ACCGACACTACCGGCGACAACGAGGATGCGGTCTCGACGCGTGCAGTCTGACGCATACCCGGCCGAAAACGCACACAGCAATTGAGCTATTCCCCGAACA
GCCTTGACGGCACCTACGGATGCATCGGAGCCTGTCAGAGCGTAGATGTAGCCCGAAAGAACCTGCTCAGATATGATACTAGCATGGCAACGTCAGCACA
TGACATAACAAG