Description :
From Genome Similarity Track
Location :
contig_30:151735- 153184
Transcript NameFunction/comments
g5296.t1DNA ligase, putative

Sequence
1449 bases(100 bases per row)
CGCCTCCGCATTATCCTTCACGTCGACACCATCTTCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTT
TCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTT
TCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAG
AATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAG
ATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTT
CACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGG
TGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCT
GCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCA
TGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGA
CTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATC
TTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCT
TCGATCGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTT
CATCAGGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGA
GAACGACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGA
AATACGGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTTTTCAGC