Description :
From Genome Similarity Track
Location :
Scaffold_69:15173- 16572
Transcript NameFunction/comments
Physo_138996reverse transcriptase

Sequence
1399 bases(100 bases per row)
CGTCATGCTTTTGACCGAGGACTGCACAGGCTGCCCACTGGTTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGGTCCGGATGACGTAGCAATGGGGT
CGACACGATCTTCCGCTTCAGGATCTCGAACGCTTCCTTCGCCCTCGACAAGTCCCTACCGGATCGCACTTGGTCGTCGCTCAGCTCGTACAGGACTGCA
GCTACCACCGGGAAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGACCCCCTTCAGAGTAGACGGGAATGGTAGATCCAGTA
CGCCCTTAGCGATCTTCGGCGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTACCGAATTCACTCTTCGGTAGACT
GACAGAGATGTTCCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCGAACTTGATCCCACGTAGGCGCCCCATGCGCGATGTCGTCAATGAAC
GAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAGCGCGGGTAGACGTCGGCCAGACA
GCATTTCGTCGTCCGATCCGGTGTCGCTCCCTCCGACGTTGTCCTCTTGCGGCTTCAAACCCAGATAATCCAGTACGTCCTGATCCATCTGAGCTTCCTT
ACCATGTGGTAGTCGAACAAAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGACCAAATGGCATCCGTCGCCACTGG
TAGTGACCGAATGGCGACACGAACGCCGAGATGAGCTTGGCTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATGTCCAGACTCATAAACCACA
TCGCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACGATCCGGTAACCAATGCACATCCG
GATGTCGACCCCGTTCTTCTTCAGTACGATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAGTCTCCAACAACTTCTTCAGCAAC
GTACACCTTCATCGCAAGGTGTGACGCGACCGAGCGTGTCCTTTGTGCGACAGGCTTAGCGTCTCCCACATCCAGATCGCAAACGACCCCGCGAGCTGGG
GCAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATACCACGTAATCGGTGTTCGTCATCTGGCGTGCTCACGCCAGGTTCGC
CAACATCTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGATCGATCCCTTCATGAATGTACAC