Description :
From Genome Similarity Track
Location :
Scaffold_2900:1517- 4095
Sequence
2578 bases(100 bases per row)
TGTGTGATCCTGGAAAGCGAGGAAGACGAGATGATTCTCGGACTCGATTTGTTGACCACGTTGGGTATCAATGTCGAGAACCAGTTGCAGCAACTCGCGG
CATCCGACGCAACGGAGCAAGACGACCCGATCGAGTTTGAGGACGATGAGCGGACGGAGGTTCAAGACAAGGCCGAGCTCATGCGTGCCATTGAGGATTC
AGTGAAAGAGGCGCTGGAAAATGGATTCCCAGTCGAACTCATCGGCGAGCTCAAGCGTATTGTATTCCTTTACGACATCTGGCGACTCGCGCTGGGAAGA
GACCCGCCGGCACGAGTACCGCCATTGAAGATCAAGCTCCGCGACGGTGCGAAGCCATACCGATGCCGTCCACGAGCGTACCCGCTTCATCTCCGAAAGT
TCATGAAGGACTTCAATGAAGAACTAGAGCGTATGGGGTGGATCAAAGAGAACCAGGAGGCCTGATGGGCTTGCCCGGTTCTTCCAGTGAAGAAGCCGGG
CAAGGAGGAGTACAGGCAGGCAGCGGACTATCGACCAGTCAACTGCCAAACAGACGCGATAGCGGGCTGCATGCCAATTCTACGCGCGATCACGGAGCAC
GTGAAAGGCATGAAGCACTTCGGCTTGTTCGACTTCCTCAAGGGCTTTTGGCAACTGCCTCTATCCAAGGAAAGCCAGAGTTTCTCTCGTACATGACCGA
TTGCAAGGTGTACACGCCGCTACGGGTGCCTCAGGGATGTACGGATGCAGCACTGTATTTTCAGCAAACAATGGAGACGTGTTTCAAGACTTTGTTGCAC
AAGCACTTGTTGATCTGGATCGATGATCTACTACTCTATGCTGAGGATATCCACACGTACCTGAAGAAGCTCGAGGAATTCTTCCAGCTCCTCGATCACT
TCGGTCTCAAGCTCAGTGTGAATAAAAGCAGTTTGTATCAGCGAGAAGTGCGATGGTGTGGGAAGATTATATCGAGTACCGGCGTCAAGCACGACCCCAG
TCGCATCTCCACGTTTAGTGAGATGCCCGAACCAAGGACTGCGGGTGAACTGCAGCAGTTTCTATGTGCAGCAAATTGGATCCGCGAGTCAGTGATCGAC
TATGGCAGGATAGTGCAGCCACTCCAACACTGCTTGGACACAGCGTTGAAGGGAGGTCGGCGAACCAAACGAGCGGCATCGTCGATACAGATCACGCTAG
ATGACACCCAGCAGACCAGCTACAAAGAATTGAAGGCGGCGATCGCCACGAGTGCCGAGCTCGCTCATCCCAGCGAGACGGCTGCGACCTGTGTGTTCAC
GGACGCCTCTGACTACGGGTGGTCCATCATTGTGACTCAAGTGGAGCAGTGGCAGGACGACACGGCTGTGACGGAACAGTCACACCAGCTTCTAGTGTGC
ATGAGCGGTGCTTTTGAGGGCTCGCAACGCAACTGGAGTGTCATCGAAAAAGAAGCTTTTCCAATTGTGAACGCGTGTGACAAGTTGAGCTACCTACTGT
TGCGGCCAAAGGGTTTCAGATTATTCTGCGATCATCGAAATTTGATTCACGTGTTCGCACCATCGGCGGAACAAAAAGCATGTGCGCGGAAAGTTACTAC
GGTGGGCTACGCGTATCCTGGAGTACCGCTACGAGATTGAACACATTGAAGGGATCAAGAATGTCTGGGCAGACATGATCTCAAGGTGGGCGGGACGGTC
GGTCGAGACGAGAAGCGTCATTCGGCGGATCGCCACGCGTAGCCAACGAAGACAGAACCTCCATGTGCTCCGTCCCTTGGACGATGAGGGTTTCGTTTGG
CCAACGCTTGAGGACGTCCAGCAAGCACAGCGACGACACCAGTCCGAGGCACGGCAGCTCGGACTGGAGCAGGATGATCACGGGGTATGGTTACGCGACG
ACAGAGTGTGGGTACCACGGAACGAAGTGGATCTGATTCGACGCATTATGATCATTTCCCATTGTGGTCCAAATGGACATCGCGGCAAGGCAGTCATGAT
GAACCAGATCAAGACTGTTTTCAATTGAGAAACTGGAGCACACGACTCTTCAATTCCTACGACAGTGCCTTTTGTGCCAACACTGCAAGGGCGGCAAGAT
TGTGCCAAGACCGTGGGCTGAGTCGTACCGAGGAACGAGGCCATGCATTGGGACTTCCTACACCTAGGCGAAGCTTTGCTCCGAGCAATTATGTGCTTGT
AATGAAGGACGATGCGACGCATTTCTGTGAGCTGGTCGTGTGCGACAGCCCGACGAGCGCTGTCGCGGTGGAAGCGATGCTGCAATGGCACAGCCGTTTT
GGGCCGCCCCTACTGTGGCTCAGTGACAGTGCTAGTCATTTCAAGAGTGAATTGCTCGCGGAGTTGTCCAGGAGGCTCAAGTGTGACCAACTATTCACGG
TCGCCTACAGCCCCTGGATCAACGGCTCAGTGGAAAGAGTGAACCGCGACATCATCCAAGTACTGCGTGCTTTGATTCTCGACTACAAGGTGCATCACAA
GGACTGGCCCGATCTCATTCCGCTGGTCCAGGCCAGTCTGAACCACTCCCCGGTCCCGTCTCTTGGCAACCACACCTC