Description :
From Genome Similarity Track
Location :
Scaffold_1902:1517- 3560
Sequence
2043 bases(100 bases per row)
AAACAGCTGCGACAATGGCTGGGTCTGGCCAACTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCGCTCACGAAGCTCCTGAAGAAGG
ATATTGAGTGGGAATGGTCCAGTGACCTTTCGGCAGCATTTGCCGAAGTGAAAAGGAGTCTGCGAGAAGCTCCTGTGTTGGCTCTTCCAAATCACGAGAA
ACCATTCCATGTGGTTTGTGATGCGAGCGACTATGCCATCGGTTGTGCTTTGATGCAACACGATGATGAGGGTCAAGAGCGAGTTGTATCGTATCAGTCA
CGACAACTCCGACCCGCAGAATGGAACTACCCAGTTCATGACAAAGAACTTCTAGCAATGAAGTATTCTTTAGTCAAGTTTCTTATCTATTTGCTCAGCG
AGGAGCGCTTCGTGATCTATACTGATCATGCATCGCTGCGAACAGCGGTAAAGACTCCTCATTTGTCGCAAAGAATGGCGAGATGGTTCTCCTTCTTTGC
AGAGTACAACTTTGTTGTGCACTACAAGCCAGGTAAGACGAACATCTTAGCTGATGCGCTGTCAAGACGTCCGGACTACGATCCAATGATGAAGAACGAA
GAAACGGACGGAGCTTGTCGACAGTGTGAAGATGTTCAAGCGATTGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGATTCTCGAAGGGTATAAGTCTG
ACGAGATATGTCAAGACCTCCTCAAGTATCTCAAGGACCCTTCTGTCAAGGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGAGAGTTCATCGCTTCCG
AGTACACAATGGGTTGTTGTACTACGCGGTGGAAGTTGAGGATACAGCACGAGTTGTTGTTCCCAACGATGAAGGACTACGTCATCGACTCTTGTATGAG
TACCATGATAGTCCTTCGGGTGACCATCTCGGACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTACTGCTGGCCACACATGTACAAGTGGGCTCGCA
AGTATGTGAGGACTTGCGAGATCTGACAACGAGTGAAACCTTCTAGTTCCACGCAGGCCCTACTTCGTCCGCTGGCTTTCCCGTCGGACAATTGGAGGTC
TGTGAGTATGGATTTCATATTCGGTCTTCCACGTGACACACATGGACGCAACGGCATCCTTGTGTTTGTGGACCGATTCAGCAAGATGGTCATCTTGCGC
CTGTTTCGAACAAGATCTCGGCTGAGAAGGCTGCACAGATCTTTGTTGACGTTGTACTCCATCTGCATGGCCTGCCAGTCGAGATCGTGTCTGACCGTGA
CACCCATTTCACTTCGAAGTTCTGGCATGCACTATTCGGACTTCTGGACACCAAGTTGTCCATGTCAACAGCGGCACACCTTGAATGGACGATCAAACAG
AACGAGCGAATCGATTCCTGGAGGACGTGTTGTGCAGCTACGCGACGTCTTTCAAAGAGTGGAGCGAGTTTCTCCCTCTTTGCGAGTTTGCGCTGAACAA
CTACACGCATGTCTCGACAGGTCACTCTCCACTTTATGTGAAATATGGCATTCATTCTCGAGTGCCTGCTTCTATAATGGATGAGGTCTCTACCTTAAGT
GGAGGAGGGACTACGGCTCACGGAAACAAGCCGAAGTAGTCTTACGATCTGAACGCTTCTTCCGAGTTAAAAGCGAATTTTGACTCGATGAAACCCCTCC
ACGATCTAACAACTCGTGAAGAGCAGCACATCGATGACTTTATTGTGAGGAAACAAGCCGTTGTGGGTTTGTTCGAGACGCGATTGCAAAGGCTCAGGAT
TTGCAAAAAAAAATAAGCAGACAAGAGTGAAAGGGAGAACAAGCAAGTGTACTCGAGCAATGATCTTGTATTGCTTAGTACGGTTAACAAGCTTGAACAT
GCAATGTCCAACTTGGGAAGCTTGAAGCTTCTGCCAAGGTTCATTGGACCGTTCAAGGTAGTGAAATGCAATGGTGATGCCTACACGCTAGACATACCTA
CACGTATGCGTCTACATCCTGCATTTTATGTGGGTAGACTGAA