Description :
From Genome Similarity Track
Location :
contig_30:151696- 156782
Transcript NameFunction/comments
g5296.t1DNA ligase, putative
g5297.t1conserved hypothetical protein
g5298.t1hypothetical protein

Sequence
5086 bases(100 bases per row)
CTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCCTTCACGTCGACACCATCTTCCACATCTAAGGAAGTAGCAAATTCG
AAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGTTCAGGAACAGCAAATCGA
AAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATC
GAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACA
ATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGG
CAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGC
GTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAA
GGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCT
CCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACC
CTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATG
ATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAG
TTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTTGTTGTACATTTCCTTGAT
GAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAATGGGGGCGCCAAGTCAACG
CACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTTGGATGACGAGACGGCCTG
TGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTC
CTCTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTCTCTGTCTTCTTACCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGC
TTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGTGTCGGTCTTTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACT
TCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTCTTCACTGGCGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCT
TTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTCCAAGGCCATGGGCAGATCCATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCG
TTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAGCCACGGCCATATACCAGCAGCAAAATAAAGAGATCCACGTACG
TTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTCCTGCATTTCGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCT
TCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCTTCTTCTTCTTCTTCTTCGTTTTGCTTCTCTTTTCTCTTGTGGC
TTCTCTTTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGTCCGCCGGTTTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCG
AAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGCACATTTGTATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATA
TACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCAGCCAAAACTTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTG
TCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCTTTAAAAAGGGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCA
CTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGATGCGACGGACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACG
GCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCACCGACTGCTGGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAG
TTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCACCCATGGACGCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGC
AAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCTGCTGCAGCTCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCG
ACGTGCAGACGGTGGGAGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTGAATGCGGGTAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTG
GCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCGCGGAACAGGTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTGCGG
AGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGTGGGGAACTACCTCCCGGAAGAGTGGATCGAGCTACTGTGCAAAGAGTT
CAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTGTTTGTTAGCTAAACGAGTTCTATTTGTTGTTCTTAAGGGTGGAGACGGAGGTGGCGGTGAAGAC
TCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCGACGTCAGACACCGAGAGTGGGTCCAAGCGCTCGACGCCTGCTACGGCTG
CTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATGAAGTCGCTGACCTCATTCTTCGGCAAGAAGTAGAGAAGTTGCAGTTTTCG
TTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTCGAGCCCTCCACGCTCACCCGGTGCACTTGCACGAAATCGCCCCAGCCAGA
GAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGCTTACAATTTGCATCTCTCCGTCGGTCTCCTTGAGCTCTGGTAATGGCAAC
CAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGCATCGAAGAGCTTCTCCCATTTGGTCGGGGTTGGTCCACTGCAGGCTTCTA
CGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGTTGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGT
CACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTACAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTG
ACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTT
CGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTTAAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTT
GGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTTTACTTGAAACACCCTCCTAGATACCGACGTCGCAGGCCACAG
CGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTG
GACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCTCTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATAC
CCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGT
GTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCATTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCC
ACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAGGCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGG
AATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGA
GCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCTATCTG