Description :
From Genome Similarity Track
Location :
Scaffold_439:15167- 16639
Transcript NameFunction/comments
Phyag_g5712hypothetical protein

Sequence
1472 bases(100 bases per row)
TCCGCTTAGCTAACATTGAGGCGGGCATGCAGAATAAGTTGGCCGCCTTCAGACGACCGTGGCACCCACATCAGCAAGGAACCACCGCCGGAACCAGGCA
GTCCCAAGAGACCAGGACGCCAGCGGTCAAGGTACAAGGTCTTGTCTCCCAGTTCCTCAACGGTAGAAGTCCACGTGACGTTGCCGTTCGCAGGCACCTT
CACTGTCTTAAGCTTGTCACCGCCAGAATGGATAACCACCTGCACGGGGTAGTTGTCGACACTCTCGAAGTGAACCGTGACAGAGCCGTcacccttcttc
ttccagacaCCGTAACTTCCCAGGAAGGCCTGGTCGATAGTGTTGAGACCCAGAGCGTCGTACAAGGTGCCATCATCGATCTCACCAAGGTACTCGGTGG
GGCCACAGATAGGCTGGACGAACTCGGACGCCATCCAGGCAATACCCGTGGGGTCGAACACGGACAGGATGAACAGACCCAGGTTGGAGTACTCGAgggc
cttctccttcttggtcacaGACTTGCCCATGTCGGTAGTGCCGTCCTCAATGAGCTGGTCAATAATGACACCGAGCGTCTTGCGGAGCAGGTTGCGCGTA
TCGTACGAGGACTTACTCGTCTTGTTGTTCCAGATCTCACCCATGCAGTGGTTGGTCACAATGGGGATGTCATCCGTAATGATCGTGGACTTGCTCACCT
CGACACGCACGTCGTTCGCAGCAGCGTTCGGGGTGTTGTTACGGATCTCGTAAACCTTGCCCATGACACGGTTCGTGAGGGTCTTGAGTTCGTAGCCGCA
GGTGCCGTTCTTCGAGTTGAGGAACGTGTCGAGCTCGATGGTGTCACCGTTAAGAGCAGTAGTGTTGAGCGCACCCGATTCACGCAGCATGAGCATGACA
TTGTccgaggacgagaagatggcCTCACCGACCATGACAGCCATCATGACAATAGCCGACACGATTGCAAGCACAGTGGCCGAGAACTGGAGCTTAGGCG
GGATCTTGATGCCAAGGCACGTGCAAATGGCCAGCGGCAAGTCGAGAATGGCGATCTGAAGCTGGAAGGCCTTGTCCATGAGTTTCTCCGTGTCGGTCTG
CGGGATCGTGGTCTGCTTGTAACGCAGGTAGTAGATGATCGACTTAACGGCGTTCACAACGTTAATAGCGCACATAAGAGCGAAGTTGGCAGCCTTGTAA
GCGGCCACGAGCGTACCGAACACACCCAAAGTAGCGGCGTTCAGAGCCACTGCAACAACCGAAGCAACCTTGGAGATAATTTCCTGCGTGCAATCCGTGT
TCTGAGGAATGCACTCCATCAAACACTCAACGGGGTAGTTGAGCGGGCACTGCGTGATAcacttgtcgtcgtcctgctggTAACCGGACGGGCACGTatt
cttgctgctgacgtccaccttcttctggtAGCAGGCATTGTCACTGGCTTCGCTGAGAGGACCGACCCAGTT