Description :
From Genome Similarity Track
Location :
Scaffold_170:15165- 19902
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_170-snap-gene-0.19Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_170-abinit-gene-0.43Cullin-associated NEDD8-dissociated protein

Sequence
4737 bases(100 bases per row)
GCGCGAAAGCCACAAATCGACTACGACGCGCTTGAAAAGGCCTGGGAGGCAGGCGATGCCGAGCAAGAGTTGCGCTCCGTTGGAGATGAACAATTCCAAA
GCCTGGCGGAAAAGTAAGCACAAGTGAGATTGTCGTCGGTATCAAAGCTAGCGCACCTGGCAAAGTTTTGACGTTTGCTTTCGTTTGATGCAGAAGCGAA
GCAGATGCCAAAGCACTGGGACCACAGATGGTGTTTGTGACACTTCGTGATGACAGCCATGGAGCTGCACGAAAAGATCTCACCGACTTGGCATCGCGCT
GGAAAGAGGTACGGCATTTTGAATACTACTGTGGCGTGGTCCTTACCTGACGATCTTGATCTCTTATGTGTGCAGTTGCTCTGGAATGGCGGCCTTGACG
TCAACATATATGAGATCGAGCACGCCAAACTCTTGGTCGGGTTGCAAAAAGGGATTCAAGTGGACGACCTCCATCGGTTCTTGCTGGAGCAACCGGAAGT
GCACGAATTCGAATGGAATGGGCAAACTTTCTCGGCATCATCTTCACGCAACGAAAAACACCAACGCCTGTATGACAAGACGAGTAAGCAACAGCACAAT
AAGAACAGTAAGAGCAAAAGCCGAGTTCATAAAGGCGATAGTAAATCCAAAGGTGCAAAGAAGCAGGCGTCTGCCACCACCAACGAGAAAAGTGAGCTTT
AACACTTCGATACTGAAAGTTGGCGTTGCTTAGCACTCATTATTCGCTGTGAAGGAAGCTTGTCGTTTCTCATTCATGCAATTGTTCCTTTCCAATCTGC
AATTCGTTCACATCTCCACACACATTTGTTTCAGTTTCCATTGCTTAGACACTGACGCGTTCGTTTTTAATCGCATCGAGCTGAGGGGCCAACGTCTTGT
TTTTCTTCACGCTCTCAAAAAGCAGGCTGAACCGAGAGTGGGTATCCGTGTCACGCACACTACTAACCGCATCAACGGCACGCAGCGCACTACGGATAAG
ATCCTTCGCACGCTCCACTTCGGTGCCCACTTGGTCTTCCTTCACCTTCTTGTTCACTGTCTTCTCAAGCGGCTCGACAAGTAAATCCAGTGCTCCAACG
ACAGATCCAGGTTGCACATGGCAGATCTTCACCAGGATCTGGTGAGAAAGCATTTGGATGTCATCTTGGTCACGAAGCCCCTGTTGGAGGTGCGGAAAGA
ACGACGCGATATCCACTTGCTGCGGCAACGTTTCGATCAGCGTATCCACGCAAGAGTACGCAGCCTTACGAATTGGAAGGCCATCATCAACCTTGTGCTT
GAATGGACCAAGATCCACCGTTCGTTCCAGCTTGACTTCAGTCGCTGCAAGAAGGGCTGGCAAGATAGGATCCTTGATGTACGGGATCAAAAAGTGTGCG
TGGTGGTGGGCACCAGTGTTGAGGGCCAAGAGAGCAGCGCGACGCACATTCAGGTCTTCATCTCGGAGAGCGTTCAAGAAAGGTTCGATGTGGGAGAAAA
GTTTCTCCACAGCAGCTGGGTTAGCTGACGCCGTCAGCGCATACTTAAGACTCGTCACACCAGTCCAGCGAGAGCCGACAGAAGAGGCTCCACACAGCTC
CGTCACTATAGGAATAAGCTTATCGCTGTTGGTGATGGAAAGCTTTCCGAGACATTCCGCTACCATGTTTCGAACTCCCTCTTCATCTCGTTCACTCAAC
TTCTTCAGCACAGGCAACACACGGTCGACGTAAACGATGAACCCATGCTGAGGACTAGCAGCGTGGTCGGAAATGACTTCCCGAAGCGAGCTCAACAAGA
GGTACGAGTTGTCGGACTGCTCAAGCTTGTGCATAATCGTCTCGAGGTACTCTTCCATGTTGCCCACACAAATGCTGCCAAGTGCGTACGCAGCAGCAGC
CTTGGTTTCTTCACCGCTCGCGTTAAAGTTTTGCAAAATAGTCTCCTTGACGTCACTGTATCCCTTCAAGCTGATTTGTCGTCCAAACTCTCCAAGACTG
TACAAAGCGAGAATCTTGTTCTTTTCCGACTTTTCGTTCGAAATGTCTTCAACAAACTTTGCAAACGCAGTGTGACGGTTTGTCTCAGTGGTTGCCACAC
ACGTAGCGGCAACACAACGCGCCATGTTCAGCAAGGAGTGCTTAGACAAGTCAGATGGAGAATCCATGAGCGCATTAAACAAGTCGTTGAAGCTACTTCC
TGGAGAATCGAGTTCAGTGAGCTGGGCGAAGAATCCTCTCAGGGCTTCCAGAGTCGGGCCTTGAAGCATTGTGCTGTGACACAGCGAAATAGAGTTCACA
AGAGCCTTCTGAAGCAACGCATCCGTAGCTGCGATGGAAGGAGAAACGCGAAGCGTATTCGAGATCACCACGATTCCTGTGCGGCAGAGCTGGAGGTCGC
TGTCAACAACAAGATACGACGCCTCCGACACCACGTCGGACAACAGCTCCTGCTTGATCTGAGCGCCCTTATGAACCACAAGATTGTTCAGTGCGTCCAG
CGCGGCTTGCTTCAGCGTTCGTGATTGCTGTCGAAGAAGTTGTGACAACGAAGTCGTGCAATCCGAGAGAATAGCGGACATATCGAGGTCGAGCTTGGAG
CGCGCAATAACAGCGATCGCCTTCATACTTTGCACACGCGTGATTTCGTTGTTCAAACGTTCCATGAGAAGTGGGTAGACTTCAGCGACCCGGGAGTTCA
ACTCGTCACCTACACAGTTTGAGGCAAATATGTTAGAACACTGGGCACAAGACGATGTTTAGCCTCAAAATACGCTTTGACATACCTAGCTCGGCAACAA
TTTGTCCGATGCTGCTGATCGCAGATTCCTTGATTTCTTGATCGATATCATGGGCTTTCAAACTTGGTAAAACGGCTTCAAACAGTGGTACGGCGTAGCT
CTTTGAGGCAGAATCGTTGATTTCCGAAATCACACGCACCAGCGATTCGATCAAACCGAGCGCTTTAGCAACAGTCTTGTACCAGTCACCCTTTGCGCAT
TGGACTGCAGCGCGGGTCAAGGCACCAATGTGCTTACGGAATGGTTCAGCTGGGTGGGAGTCGACCAGCAAACGAAGGAACACAAGAGCATCCAGCTTCA
AATCTGAATGCTTATCTTCCGCAGCGCGAAGAATGTTTGGCATCAAGATCTCAATGTACTCTCCAAGCTGACCACGTTCAACCGCCGCTAGTTCACTCAA
CACCGCAATCACAGCACAACGCGATGAGACCGACGCTTTTGGGCCAAACTGCTTGTTAGCAGACAAAACGATGACTTTCAACCGCTTATGCACTTGCTCG
ATGCACTTGTTCGCCGAAGGAGAGGCGCCTGAGTTTGTTAGCGTTCGGTTTGTCGCGCGAAGGAGCTCAGTGAACACTGAGAACACATCGATACGCACAT
TTTCTTCACGCTCCTTGAATCGGGAAATGATTTGCTGGCTGTAGGTTTCATACAGGTGCTCCAAAAGTTCCGATCGGGTCGTAATAATCGCTGTGAGAAC
ACGAAGACCTGCACGTCGCACTTTCCAACTAGTGTCGTCATCGTCACTGTAATCTCCATCATCTTCGTCCGAGTATTCTTCTTCATCCTCATCCATCGGT
TCATCCTCATCCTCTGACTCCCCGTAGTTGTAGTTCGGGTCGTACTTGATAAACTCCATCACCAACGTCAAAATGCTCTCCACGTGAGGAGTGATTTCAT
TATGGCAACGAATGACAAAAGACTCGAACGCCTGGAAACAGTTCTCACGAAGCTCACTTGATGCTTCATTTTGCAACGATTCGTCTTCAGGGTCACCGCA
AAACTTTACCAGAATTGGAATGATCGCGTTCAGGTGATGACCCAAGCGATGGCCGGCAGTGCGGGACAATGTACCGATTGTCTGAATAAACGTGCGCACA
TCCACAGATCCGCTTGACGCTTCAATGCCCTTGATCAGGTGCTCGACAAGGCGGGTTAGCAAAGCATCCGATGCCATAACACCCAAAGATCCGACACATG
CAGTTGCACGCTTACGAACGAGTGGCGATGAATCATTCAGCTGCGTGATCAAAATGTTCATGATCGTGTCGTGCTCAGTCGAGATGTCGTGTCCAAAGCG
ACGCAACAAATCCGTCAAGATATCAAGAGTCTCTGATTTCACAGCTTGATCCTTGTCTTTCCCAAGACCTTTCAAAAGACGCGTGCACAATCCCGATGCA
ATCGCAGCACCGATTTTCGTCGACACATCCGTGAGGATAGTCTTCAAGCCAATCGAGTAAATATCACGCAATTCTGGCTTGCCGTTCAAGATGAGATCAC
TCAACTTCGCGCAAATGTCAGCCACTTGGGACTCTTGCACCTTCGTCACCAAAATGCCCAAACTATGAAACACAAGAAATCCAAAGTATTCAAGCAAAGG
TTAGAATCTTCACCCTTACAAACAGTTCCACTCCAGTGTATCCATTTTGTACCATTTCACTGCAATGGCTTGCACATCGTTCGACTTGTCGTCAAGTTGC
TTCAGCACAGCAGCACACACCCTACGCAAAAGAAGGGGAAAAAAAAGCAAGCCGTCAATCTCTTCGCTCCAGATTCACCATATAGGCTATTCGCTTTGCT
AGCCAATCGCATAGGACTGGCAGACTAGCAACGTACTTTGGCTCGAGGTATGGTCCCAATTCCGTGTCCTTGTTCAGTTCGTTACAAAGATCCGATGTCG
CCATGTATCGCTCATCTTTGTCGAAATCCGTAGTCTA