Description :
From Genome Similarity Track
Location :
Scaffold_58:151648- 154589
Sequence
2941 bases(100 bases per row)
GGATTACGGTAGCTTGCCTTCCATCAAGGTCTCTCTTGACCAGTGGATCGGTGGGTACACAGATCGCGTACCACGACCGTCTGTTCTCGCCCTGGTCGGC
ATGCAGAGTCAGTTGGACGAGTGTCGCGGAGGTGGACGTCGATCTCTTGTTCCGTCACTTCTTCCCTCCCAAGGGTATCCCTTTCCGACGTTACCTATGC
GTAAGATTCCACCTCCCGCATCCAAGTGGACTCCTCGGTTAGTATCTTCAGCCCAGATCGCGACCTTATACGGCCAAGAGTCTTGAAGGAACACTTTCCG
CCGGATCGCACCGATCTCTTTTCCTCGTACCGGGTGGTTCGACCAGCTCGCCATCTTGTATCTGGAATTTGATGATTGAAACCGACAGGCTTTGTGGGAG
TCAACGCATGTAGTCTTCCTTTCTAGCGAATGTACGCGATCCCTCAAATATGGAAGCAGAGGAAAAACGTCGATCGCAAGCTGGGCCCCGGTGGAAGGTG
ATCCTTCAATTATCTTGCAGGGTATGATCGCGGGCTGTTGCGACCTGGGCATTCTGTTGGATCCCTTCTTCATACACATCCCATCCCAAATGGAAGTGCC
CTCTTGGTATCCAGGCCTGGGATGCAAACATAAGAACATTCCCAATTTGATCTCGTCTCTGTCGCAGCTGGATGCCGCTGAGCCTTGGCGTACTCAGTAT
CGGTCTTCTATCGCTGAACATCCCAAATTGACGATCCCACGTTTTCCTGGTAAGTTCTTTCCTGCGTGATCGCTAGGTTTTGGTTTATATAGCTTCGTAA
TTCAATATAATTTCCCGTCGATCTTTCATCTTATTTTTCATCTAGAAATTAACTTCATCTCTTCGGCTTTTCAGCCGCGATCGGACTATTACGATCTCAT
ATTGCCACACAGTTCACATATAACCCCAATTCCACCATCTCGTACAACCTCCTTGTACATATACCCATCTACCATCTCGTACTTCCTCCTTGTACACATG
CCCATCCACTATTTCATACAATCTATTTGTACATATTCCCACCCACCATTGCGTACACAACTCCTTGTATACGTCAACCACTTGTCGCTTCGATTATTTG
TTAATCCTCGGCTTCCACTTGGTGAGATTGCATCACCTCGAACCGATTTTGACTTACACTATTGCACTCAAAATCCTGCAGAAACGCGCCGCAGTTCAGA
TCTGCTTCGTCGATCCAGGTCGGATCGCTATGTAGCTTCCACTGCACCAAATATTGTCTGTGCACTCGGCCATAACGGGTCTTACGTCTTGGTCGCACGT
CCAAACGTTGCCCCACTTCGCATTCATCTGAAGCCAACTCGTTCTCCTAACTGACTTCCGGCAGCAGCGACTCACCGAAATCCACGGATCCTCACAGTTG
ACCACTAACGTATTGCCTGGGCTATCGGGGAACTGTACCACTTGTTTTACCTTTAAAACGTGCAATACTGGAAACAGTTGGTATGGAGTTCCTGCAATCT
CCAAACGGACTGCATGATCTCCACACAACTCAGCCACTCGAAACGGTTCATGCCACATATGTGCTAACTTGCGAGCGTATCCGTCTTTGACCCGATCCAA
ATAGAGCCAAACTTGCATCCTGCACTCTATGTTACACGATCTATGATTGATATTATGCTGATCTGCTCGATCTCGGATTACGATTTTGAGACGTTCGTTT
ACTGTCACTCTTGCTCTTTGATATTGACGCTGGATATGATATCGCCATCTTGGAGGGTCGACATCGCGTGTTTTAGTGCTTCCTAACGGTAGGGATGCCT
CCAAAGTCGATCTTGGATCCCATCCGTGGATCGAATAAAACGGGGTATCTCCACCGACGCGAACATGTGCCGTATTCCTGGCAAATGTCATTCTTTCCGC
ATATTTATCCCAATCCTTTTGATCGACGTCCGTGACGTACATCTTGATCGCTCGAGTCAACTTCTGCACCTTGCGTTCCGCGGTTCCGTTCTGTTGCGGT
CGGTAAGCCATGGTAGCACGCTGCTTTTTCCCTGCAATCCGATTAAAAAACGCGCAAAAAAATCTGATTTAAATTCAGGCCCCCGATCGTGACGTATCGC
TTCACTTGCTCCAAATCTTCGGAATACACATTCCTCATAGCCTTCAGCGATCGCTCGTGCGTTCCTTGACGAAATTGCCCTCGCGATCACGTAACCCGAG
AAGCGATACACCCACAGCAGCAGTTCGGTGTTTCCTTTGAACGACCTTGGCAGAGACGGGATGTGATCCATTGCGATCACCTGAAATGGGTATGTAGCCT
GTATATTTCCAGGGGATCTATCATGGAAAGGGGTTACCCACGCATTCGCTAACATAACGCTTGATAATCCGATATAGACTTCTCCAATGGAAATTAGACC
TGATCCGCTGATATGTCCTCCCGATTCCTTGGTGATCACCTTCCAAGCTCGCATGGTAATGGTGTATAAAGTCCTATTGTAACAATTCTGGTACAACCAG
ACGGACCATCTCCATGCGATCGTCCGACTATTTAGAATATCGTGGGCTGAAAAACAGCAATCAATTTTCATCGACTTCGTATTCTGGAGAGATCCGGGCG
CATAACTTTGCATCTTCGGCGTTCAACTGGGTTAAGTTGCCTATAAGATATCCCTTCAGGTTGGCTATCCAGCTTTCTTCTCCTTGCGCCTGCCTTATCC
GCTCGGTCGCATCTGCTGCACTATTTCTTATTGCAAAACTTCGGGTTGTCGACACGTTCGCTTCGCGGATCGTGGGATCGCTGCCATCTTCACTACGCGG
TCCACTTTCTTGGCATTAACATATCGTCCAACCGATTAAGTGATATCCAATCTGTGAATCTTGACCCGACGTTACGATTTTACCTTTCTCCTGCTGCAAG
GCTGCACTCGCTAGTCGATCTGCGCTTTGGGTTCCACTGGC