Description :
From Genome Similarity Track
Location :
Scaffold_187:1516- 4450
Sequence
2934 bases(100 bases per row)
CTAGACGATATGTCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCAAATTAGTGGTCATTAGACCCGATGTTGAGTTGAACTCGTCCT
CATTAATGGATGAGTCGGTCCTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCCTCGATCCTTAAAGATCCTTTGGATCCCTTCTATCCTTT
GGTAAAGGAATTTCAAGATGTGTTGTGTCACAACCCACCATCTGTATTACCTCCTGATAGAGGTATACGTCATGAAATTGACCTAGTTCCAGGAACTAAA
TACTGCGTAACACGGCAGTGGCCTTTACCTAATGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGATGCGGGAGAGTA
AGTCTCCCCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAACAAGCTTAATGCTACCACTATCCCGGC
TCAGACACCAATCCCCAGAAAGGATGTTCTTCATAACAATATGGTTGGATGTACATTGTACAGTGCGCTCGACTTAGTTGATGGTTATTACCAGCCGCTC
ATGCGAGCAAGCGATATTTCGCTAACAGCTGTTACCCCGATCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCTGGCTACTT
TTAATCTTCTGGTGACGCAACTATTCAGACCCCATCGAGGCTATGCACAAATATACTTTGATGACATGTTTGTCCATAGTCGTGCAACGAACGGTCGATC
CGATGTGGATAATCACATTAATCATTTACTAGCGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGATGCAGAA
GAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAAGCCTTCGAGCGGACCCCGCCAAGATAAGGGCCATAGTCGATTGGTCGGTTCCAAAGAACCAAA
AAGATTTACGTAAGTGGGTTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATATGGCTCGGCCATTATCCAATCTCCCTAAGAAGGA
TGTGAATTGGTGTTGGGGTGACACCGAACATGAGGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGACCGATCCTGATCGG
CCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGGCATAGCCAGTGCTCTGTTACGAACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTA
GACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGGGTACATCTGCTTGGCTC
AAATCCATTTGTGATCTATACAGATCATTCGTCATTGCGCACTGAGACACAGTCGCCGCATCTCTCTCAGAAGATGGCTTGTTGACTTTCATCCTTTGCC
GAATATAACTTCGAAGTGAAGTATAAGCCAGGGAAGAAAATACTTTGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTATGCT
GTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGCCAAAGATGAATAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTTAAGACTCG
GACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCTTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTA
ACGCTGTCCATCATGATGAGGAGTTGAACTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTC
AGTGAGCCAGGCTTATTAGTGGCCCAAACTATAGAAGTGGATGAGCACCCATGTGCGTACGTGTGAAACGTGTCAACGGGTCAAACCCTCAGCACATGCG
GCGGCGCCGCTGGCTAGTCTGACTGTACCCATTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTG
GCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCCAGCGGCAGTGTCGGACTCTATCGATGCCGAAGGTACAGCGAAGCTGTTTAACGACCA
TGTGTTTCGACAATGGCTTGCCAGTGGTAATTGTCTCTGATAGAGATCCTGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGT
TTGGACACGTCCATAGCGGATCATCCGCAGACCGATGGTCAAATTGAGCGCGTTAATCGCGCCATTAACGACATTTTGCGCAGTGTTTGCGCTGATACGC
CTAAGCGTTGGAGCTCCATGCTCCTGTTGTTGAGTTTGCGTTGAACAACGCTGATCATGCCTGTACAGGCTATACTTCGTTCTACGTAAACGGTCTCACC
CACCCTCGCGTTCCGTTAACTCTACTACTATGTGGTTCAGGGCTTCGTGGGGGAGAGATTGCCGATCGGCTTGCTGATATCAGCCATGCTACTGTCCAAA
AACAGTTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAAGACATGTGCGTGACGCAATGGCTGAAATCAAGACCAACAAAAACAACAAGCAGATGCT
AAAAACAGAGGTTGTATTGAACGTTATAAGGTCGGAGACCAAGTATTACTCAATTCTAAAAACCTACCTACAAATGTAGTGTCTGCTGTCTTTAAGACAA
AGTTTCGTCCACGCTTCATTGGACCATTTACAGTTACTGCCAAGAAGGGACTTGCGTATACGCTAAACCTTCCGCGCAAATTGCGCACACACCCAGTGTT
CTACGTAGGCTTACTTAAGCCATACCGAGATCCT