Description :
From Genome Similarity Track
Location :
contig_1:1515693- 1517084
Transcript NameFunction/comments
g446.t1hypothetical protein

Sequence
1391 bases(100 bases per row)
CGTGCACAGGTTCTCCACTCCATCCCACACCACATCGTACTGCCACCCGCACATGTCATAAAAGCTCGGTCGAAGTCGGCCAGTTAGATTCTTTGTGAAC
TCCGTCAGCAGCTCGCTCATACTTGCAGCCTGCGCCAACGTCAGAAGGAAGTCGCGCGTGTCGTGGGGGACAAGACGCACTTTGCAAAATCTCGGGAGAG
TGTAGTTCATCACCAGATTGACAGTCACTGGAACTGCCACGCCGAACAGCACCAACGTCTCAGTTGGGACTTGCTCGGTGCGCACCTTGGCGTTGAGCGT
CGCGTCTCGAGCCCAAACTGTCGTTGTCGAGTTGATTTGTACTTCAACATTTGGAATGGGACCTATCGGAACCAACGAGGTGGGTTACATGTAGCTCCAG
TTCACCGGTACATGTATGGACTACCGATTGCTTACGTTGCTGGACGGGGATCAGCGCGAAGAAGAGAGCGAGCCCGAACATGATGAGCGTGCAGCTGAAC
TCTAGCACGCGGTATTCGCAGAGGAGACGCTCGATCTCTCGCCGGCGGACGCTTCGACTGTCGGGCGACGAGCGCTCAGGGGATCTTCCCAACATGAGCG
TGTACTCGTCGTCGCCATCGTCGTCGAGCATTGTCGTCCCTGTGTGCCTCAATAGTGCAAGGTGGCTTTTAGCCAATCAACGATAATCAACTTGTGCTCA
GATGCTATTGCCATGATAGATGTCCTCGAGGACGCAGGAGACAAGTACGCGTCAATCTAGTGCCCGGTGATACATGTAGCAGGCAGGGACTCACTCGCTG
GGACGTCCTTGATAGCCCCAACGGCAACTTGTCAAACAATAAATCCTGGACAAGTTGAGCGTTCATTAGAATGCAGTTGTTGGGGGAATTACACTGTCCT
CATTACATGCAAACACTGGCGCGCCTAATTACCATTGGCGTGGACGTTCATAACGTAGTCGCCGCGCACATTCGGCTTGCCCAACTCGCTTCCCTGGTCC
GTGGAAAGCGATCCGCTGCTGGCGTAAGTGATGCCGCTGCTGCTTGAAGTCAGTTTATCCTGCTACCAACCGAATTGAGAGGTCAGTCTTAGGTTAGTTA
CCACTTGTGTCAGCCATAGCCGTCATACCTTGCAGCTTGCGTGGCAGCCTTGGAGAGGAACACCCGCATGCTGGCTGTGGAAAATCGAAGCGTAGTTGAA
GCTGTACGAAATGCACGCAGAGACTGCGCCAATGATGCTTCCCGCGAGAATGTCAGCGTAGTGGTGCCAGTTGTCGATCGTGCGGGTAACAGCTACCCAT
GCTGCTAAAAACGTTGGAATGAAGCAGAGGAACAACTTGAGCGTCTTTCGCCCGCCTCGCATCATGGTCTCGCTGCGGTTTTCGCAGTTCA