Description :
From Genome Similarity Track
Location :
contig_1:1515614- 1517005
Transcript NameFunction/comments
g507.t1hypothetical protein
g508.t1KUF97242.1 hypothetical protein AM588_10011359 [Phytophthora nicotianae

Sequence
1391 bases(100 bases per row)
CACCCGCACATGTCATAAAAGCTCGGTCGAAGTCGGCCAGTTAGATTCTTTGTGAACTCCGTCAGCAGCTCGCTCATACTTGCAGCCTGCGCCAACGTCA
GAAGGAAGTCGCGCGTGTCGTGGGGGACAAGACGCACTTTGCAAAATCTCGGGAGAGTGTAGTTCATCACCAGATTGACAGTCACTGGAACTGCCACGCC
GAACAGCACCAACGTCTCAGTTGGGACTTGCTCGGTGCACACCTTGGCGTTGAGCGTCGCGTCTCGAGCCCAAACTGTCGTTGTCGAGTTGATTTGTACT
TCAACATTTGGAATGGGACCTATCGGAACCAACGAGGTGGGTTACATGTAGCTCCAGTTCACCGGTACATGTATGGACTACCGATTGCTTACGTTGCTGG
ACGGGGATCAGCGCGAAGAAGAGAGCGAGCCCGAACATGATGAGTGTGCAGCTGAACTCTAGCACGCGGTATTCGCAGAGGAGACGCTCGATCTCTCGCC
GGCGGACGCTTCGACTGTCGGGCGACGAGCGCTCAGGGGATCTTCCCAACATGAGCGTGTACTCGTCGTCGCCATCGTCGTCGAGCATTGTCGTCCCTGT
GTGCCTCAATAGTGCAAGGTGGCTTTTAGCCAATCAACGATAATCAACTTGTGCTCAGATGCTATTGCCATGATAGATGTCCTCGAGGACGCAGGAGACA
AGTACGCGTCAATCTAGTGCCCGGTGATACATGTAGCAGGCAGGGACTCACTCGCTGGGACGTCCTTGATAGCCCCAACGGCAGCTTGTCAAACAATAAA
TCCTGGACAAGTTGAGCGTTCATTAGAATGCAGTTGTTGGGGGAATTACACTGTCCTCATTACATGCAAACACTGGCGCGCCTAATTACCATTGGCGTGG
ACGTTCATAACGTAGTCGCCGCGCACATTCGGCTTGCCCAACTCGCTTCCCTGGTCCGTGGAAAGCGATCCGCTGCTAGCGTAAGTGATGCCGCTACTGC
TTGAAGTCAGTTTATCCTGCTACCAACCGAATTGAGAGGTCAGCCTTAGGTTAGTTACCACTTGTGTCAGCCATAGCCGTCATACCTTGCAGCTTGCGTG
GCAGCCTTGGAGAGGAACACCCGCATGCTGGCTGTGGAAAATCGAAGCGTAGTTGAAGCTGTACGAAATGCACGCAGAGACTGCGCCAATGATACTTCCC
GCGAGAATGTCAGCGTAGTGGTGCCAGTTGTCGATCGTGCGGGTAACAGCTACCCATGCTGCTAAAAACGTTGGAATGAAGCAGAGGAACAACTTGAGCG
TCTTTCGCCCGCCTCGCATCATGGTCTCGCTGCGGTTTTCGCAGTTCAAGGTTGAGCGCCCTAGCAAGTAAAGCTGCAGGCATAAATATTA