Description :
From Genome Similarity Track
Location :
scaffold_199:15156- 16159
Transcript NameFunction/comments
Pl_107834conserved hypothetical protein
Pl_107835hypothetical protein PHYSODRAFT_295319

Sequence
1003 bases(100 bases per row)
CTGCGTAGTGCTATTGCAGCTGCAGTCCATCATACCTGCTTAACGAGCGGGTATTCAGCGTCGATATGGAATACAGGAATGATGAAGCCTGAACACCTGA
AATTGCATACTCTAAACAGCAGCATCGACGTCTACGTGCGGTCGCTGATCTTGAACTCCGGAAAGTCAAGGTCTGGCTGCCAGATACCCTGGATGGTTGG
ACGCTTCGAGATGACCGGCTTTTTGATGTGCGTCATTTTGCGCCCGCTAGAATTGCGAAGGCGTTCAAGCTGCAAAACCACATCGTAAAAAAGTGCCAAA
TAATCAGTTAGCGCTGAGCAATAGTAGATAGCAGCAATGCTGATTAAGCAATGCAATACTTGTCAATATGCTTCGAGTCGCACCTGCTTCATGATGAAGG
AAATGTCCTGGTTCTTGATGTCCGATACCTTGCGCTCATTTGTCACTGCATGTACACAATAACATACCGTTTGTCATCTTGTTCCCAGCCTTAATATCCC
GGTATTGCTACTGTCGAGCAGTACGCACCATAGTCTCCGATCAAGATGGGGTGGCGTGCACCCTTGAGCTCCGTCTCAAATTGCACCTGCGGGTTCTCCT
CCACGAACTTGAGGAAGCGGTCGTCACCCAGAAGCTGCCGCACATAGCGGCTGCTGCCGCTGTGCTGGCAGTAACGGATCGTCACTTGCTTGAGCTGCCA
CACACCCTTGGTCGCCATGGTCTAATACGTGCGGTCAGAGTCGCTGTGAATCGTTTGGTGTTGGGGAGCTATGTGCACCACACCACAGCAGCTTAACGTC
AAGGTGACCATCACTCCTACTTCAACGCACTTAAGTGGGTCGATTATAAAGCAACAACTTGCCGCCAAGTGCGCACTCTCATGGCGACCCATCCAAGTGC
AGAGGAAGCCGAGAAGAGCGACGTGGATAGCCTACTGAGGCTTGTTCGTGCTCACCAACGCCAACATGATGACCGCACGTACGACTCGAGTGCTCCTGCT
GCG