Description :
From Genome Similarity Track
Location :
scaffold_5:151551- 152831
Transcript NameFunction/comments
g8123.t1hypothetical protein

Sequence
1280 bases(100 bases per row)
TATCAGCACCTCCACTTCGAATCTGCATGTTTCGCTCCACGGTGGTGTCGCCTTGTTTTCACACCGATTCTGCCTGGAGTACGCGGCTCGCCAAACATCG
TCCAGTGTTGTTGATCCTCTCCCTCAACCCACAGAAGGTCATAGTCCATTGAATCCTGGGCTGTGATTGCTGCAAGTAGTGAGGTCAAACCACAGAAACC
GCTCAGTATCGTCGATGCACTCTCAAAAATGGACCAGAATGGTTTGAAAGACGATGCGCTGGCAACTCGACTTCGAGTAAGGGAGACAGATTTACTTGCG
TTGGAATCCTCTTCATCTTCGTCTTCGCTATCCAAGCCCAGCCCAGCTGATATCACCTGCTGCAAAGTTGCAAAGAGTGTATCGCACTCGCCGAACGTTT
TGCGTGGTTTGTGTGGAGACAATTCCCGCTTTGCATTATCTTCGCGAGCATCGACATCACTCTCCAATTCATCGGAGGTATCTGATACGCTGTCTTCTTC
GGAGATATTGGTCGAGGATCCAGCTGAATAAATGCCTCTGTCCACAGCAATGAACCCTGGAGATACCGACGCGACCCCACCATTACGGCGAAGCTGAACG
CTGTTACCTCTTGGCTCAGGCTGGTCGCTATGCTCCTCCGAATCACTTTTGCTGTCTCTTCTGTTGGACACTCGTATTTGGACTACTCTTTTCTTCTCCC
CTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGCTTCGTCCACGCGGCGCCT
TTTCCTCTGTATTTCCTCCGGGGAAATAGTCTTGGACGTGGCAACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGATTTGACGCTCGAGTTCCCC
CCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGCCCTCTTGTTGGTCACGTG
GAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAGCTCCCTCACACCCACGTC
TGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCCGCTGTAGCGGGCCACACA
GCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCAT