Description :
From Genome Similarity Track
Location :
Scaffold_517:15155- 19023
Transcript NameFunction/comments
Phypl_g9078hypothetical protein PHYSODRAFT_354314
Phypl_g9079hypothetical protein PHYSODRAFT_359933
Phypl_g9080hypothetical protein

Sequence
3868 bases(100 bases per row)
cgcggccgcgttcatggcgctggtggagcgcaGCAACGGGGCAGCCAggctgctcaaggccaacaagctgcgcgaggccgaggcgctgctgcgcgacgtg
ctggagcgcaagccCGCCGCCGGCTTCGACGAGGTGTCGGTGGCACTGACGCAGAGCGAACTGGGCGGCGTCCTGCGGCggctgggcgagctggacgagg
cgctggcgctactttcggcggcgctggaggtaCGCGACCGCGCCAACGAGAGGGCGGgcatcgccatcgcgctgCGGGACGGCAACCTCACGCGTGAAGA
GGTCGCCAAGGTGTACGAGGCCAGGGGCGACTGcgccaaggcgctcgagctgcggcagccAGGCACGCGCATCTGCGGCAACGAGGCCTGCGAGGCGCTC
GACTACAAGGACGaaaagaagctgcacgcaTGCAGTCGCTGCAAGTGCGTCTTCTACTGCGGCAAATCGTGCCAGCGCCAGGACTGGAAGAATCGCCACA
AACCGCTGTGTCAGCCCGTGGAGACGACCACGGCGTCGTAGCTCCTGGGCTGAGAGAGCTAGGGGGCGCTAAGTTTTATTGTTTGAGGCATTGAGGACGG
CGGGGTGCTGGTGTTAGCGTGGAAGCGGAAAAAATTCTCATTTCAACGGGGCCAGTGACTGGTGACAACCCTTTTACGGGTTACAAGCAGTGATTTCGAG
GTTTCTTGTGGCATCAATGAAAGGCACAGATTCGACCTTAGGGAAGTACCAAGCGTTGACGATTACCCACGATCGTTATACCAAACAGATTGATTGTACA
CTTGCGAGCCCAGGCTGAGTCTCCATCCGCAGGATCGGATCCTTTTAGTGCTCCGCAGCACACACGGCGACGCGCGGATGCCATCCATCTGCATGTAGAT
ATTGCGGCCGGTTTGAATTTGACAACCTTTTCGAGGCTCTGGACGAGAAAAaagctgcacctcgtcgtggtcgatctacatgtagtcaGCTTTCCTAATA
GCGATGGTGAGGAGAATTCTACGTGTAGTCCCACATCGCGATGCTTAGTACGTCGTTAATAATGCATCACGGTCCTAGCATTATTTTAGGTGCCTAGCGG
CATTTGCGATGCAGCCTCATTCGAGGTTCGCTGAAAATTTGCGTTTACTGGCACAGGGATGTTTGAACCAAAGTATCAATTGCCCCACTGAGTATTGGTT
CGTTCCTGTCGGTTCCATCCAGAGTATGGTAACCAAAGTAatactacttcgaagtacatgtCAATCTGAGGGAAGTGCCATTCATTGCACTGACAGGAAA
GGCTTGTACTGTAGATGAGGAATTTCGCGCCAAATGTTTATCGTTTTACTGTAgtattacatgtacatacACTTACTACTACCAcgtaatacatgtactg
ttGAGACTTGAATGCTGGGTTACCTTGCCAGACAATCACAATTGCCCagacgtggagaagcttAATTTACCACTAGTAGGTATCAACTGAGATCCACATT
AGTACTCAGTATAAACACTTTCGTTAGCAAAAATaaaatgcagcagcaatcgAATCGCAACAGCGTATCCGATCACTTctgcttgtcctcctcctgacTA
CCGCTGTCGTTCTCAGTCTTTTCTTCCccctcgtcttcctcctctactgtctcgtcctcgtccagctccacagGCTCGTCCTCGCCAGCCTCTGCCTCAT
TGAGCGGGGCGTCGTCACCCTTCTGCTCCAGAGCAGCGAGCTCCTCAGCACGCATAGGCGGCGCGATGAACCACGGCAGCTTGCCACGCTGGTAGTCGTT
GATCATCTGCACGGCGACATTGTTGTAGTCGGGCTCACCCTTCGGGAGCAGCTTGCCACACTTGTTGGCGAGTTTCTCGAGGAAGTCCCCCTCGTCATTC
CACTCCTCGATGCCGTACACCTTGACAATAAACTCCTTCTTGACCCGCTGCAGGATGGTCAGAATGAAGTCCGTCGGCTGAGGAAGACGCTCAGCACGAA
CGACACCCTTGAGCACGGTCTCAATCTCGTCGTCACCCGTGTCGTAGACGATACCGGGGCAATCAATCAGGAAGATGCGGCGCATGAGCGTAATGTACTG
CCACACCTTGGTCTCACCCGGAATGGGAGCCACCTTGCACACCTTTTTCTTACGCAGCGCGTTGATAACCGAACTCTTACCGACGTTCGGGTAGCCAATA
AGTCCCACCGagatctgcttcttctcctggtgcagcttggcgaactggcgcagcaggttgaTCAGCGCACCCTTTCCGAACGGGTTGCTCATGGACGCGT
GGAACGCCAGCGTAGGCGTAGTCTCGCTGAGCTTCTGCACCCAGCGCTTGGTGACCCAGTTGGGCACCAAGTCGCACTTGTTGATGACAAAGATCAGGTG
CTTGTGCGAGGCATTTTTGCGGatgtgcttctccacgtGATCACAGCGCGTGCCCGGCACGTTGCGGGCGTCCAGAACCTGGATGACGACGTCCGAGcag
tccagcaccttgtagAGCTCGCCCCAAATGCGCTTGGACTGGCCCTTGTTGAACACGTCGTGCGAGACCTCCACCTTGAAGtcctgctccacgacgaTGT
TGCGGTCCGGTCCCTTGGCCTCGTACTTCTCCGCATTATCTTGAGCTCgggagagcagcgacgcgtagTCGGTGGCCGCGATCTTAGCGCGCTTGCGGCT
GCGCTTGCCGTTGAAGACCTCGCCATAGCTCtcggtctccagcagcttcatgcgcgacgtcttctcgctctcctgcagcaggcccATGGGCAACTTGCGC
GTGCGCAGGACCACGGAGTACGGGTCGGCGGCCTTGAGGGACATCTCGTTGCggaacttgtccagctccttctgccCCACGACGCGCGTGTTGCCGAACC
AGCGGCGGTCGGGCTGCACGCGGCcgctggcggtggtgatCTCCTGGCCACCGACCTTGTTCTTCATCATGAGGTTGCCGCCCACGACCTTGCCGGCCTT
GTTGCGGATGGGGCCGCTGTTGCGGTACATGTTGAGGCGCTTGATGGTGCTCTTGTCGCGCATGTTGGCCGCCTTCTGCCGCTTGGGCATCTTGCGGTTC
GGGTTATCGGCCGACGCCTTGGACGTGTTCAGGCCCTTCGCCATGGTGCTCGACTGGGTGCGGCGGGCAGGTAGATAGAAGATACTCacgcggcgatggc
ggcgacaaTTCCCCTTCCTTGCGCAAAATGACGGCCAAGTAGCTGTTCGCCTGGCCGCTGGGACGATTGGTTGGACGCGTCGACCGCGCACTTTTGACCA
ATGACAGGGTGCTCTTTCAACCAATCAGGTATTTCCGCCAGCCGCATACTGGTACGGTGTACCACTAGTGACAGCGCCGCGTCAGGTGACGTTTCATCTA
TCTCTTTATTACATTCTGGCCCCGACAAATAGTGCTACTTTAAATGCTTCCTATCTATTGCAAACTACGCTAGCAGACTCTCTATTGCAATTATAGCCTC
GACAGACCAGATCAGGCAGCCTTCTTCATCAGACGCAGACTTCGACGACCATGGCGAGCatggcgctcgcggcgcagcagcagcaggagcgcgccGAGAT
GGCCACGTACCTGTACGAGAAGCACCTGAACCACCAGGACGGCGTGGCCGGCACGCTGAGCATCCGACTGGTGGCCGCCCGCCAcctgcgcgccgccgcc
tccatgtTCTGGGTGCGCACGTGCAACCCGTACGTGATCTTCCGCTTGGGCAAGCagagcgtgcgcagctccaccatcCCCAGCAACGACAACCCAACGT
GgcgccgcgagctcctcgaggtgaagctgcccAAGCTGGACCACAAGCGCCAGCCGCTAGGCGAGCAC