Description :
From Genome Similarity Track
Location :
Scaffold_1:1515463- 1516774
Transcript NameFunction/comments
Phyin_T30-4PITG_00245Cathepsin%2C cysteine protease family C01A%2C putative

Sequence
1311 bases(100 bases per row)
GAAGAGCTCTTCGCGCCTGGTAGAGAGAACATGGCACCACTCACCTGCAACTGCATACCACTTCGCAATTATTCTTCAGCAGCTCTAAGCTCCCAAGTCT
AGCGTGATGGCAATCACCGACAAGTCCGATCTTCCGCTGTTGCAGCCTCGCATCAGTCCTCTGCTGGACGTCAACAGCGTTTCACAATCTTCAACATCTC
CACTGCAATCGATTTGGGAGAACTTCCACGCTGACCGCTTTAAGCTGCGGTCCATTGGCTCTGTGCTTATGTGGATCGCACTGGGGAGTTTTGTCAGTTC
CGCGGTGCTTGCACCTAAGAAACTCGTCGATTACACGCACAACGGGGTGTCGATGCACGCGGTCCAAGACCAACTCGACTTGATGGCAGCGTGTCCGCCC
GACGGTAAAGGGGAGGGCGACGTAGACGTGGTTCAAACCAACAAAGGTGCCGGTTGGTTCCTTGGTGGCAACGACCCCGAGCACGTACTGTCACCGCTAC
CGGAAGTTACGTCGTTAGACGATTTTCCTGAGCGTTGGGACTGGCGCGACTATAACAAGACGGGTATCAGCTTGACCACTAGCGTCATGAACCAAATGGT
GCCCCGTGCTTGTGGGTCTTGCTGGGCGTTCGCTACGGTTAGTGCGCTGTCGGATCGAATTCGGATTGCGCGGTTCAAAACGACCGGCCGCCTTGACACA
GAGGTGCTGCTATCGCCACAAGTCTTACTCGACTGCGGTATGCGATCGTTTGGGTCGTGTCACGGTGGAGATCCGCGATATGCACACAAATGGATCCATG
AAAATGGTATTGTCGACTTGACGTGCAACCCATACATTGCCTCGCATCCGTCGTGGATGGGAAGAGGTGACTGCGCGGCGACGCAATGCCACACATGCAA
TCTGAAAGGTGAATGCTTCGTGTTGGAGGACCCAATCAAATATCGCATCTCGGAGTACGGCACACTCAACTTTGCGACGTCGGAGGAATTCCAGCTTCAG
GCGATGAACGAGATCTACCACCGTGGCCCCATCGTTGTAAGCATGTACTCACTGTCACCGGAATATCGTCAATATAAAGGAGGTTACATCCTGCGCGACT
CAACCAAGTACCCTGGCACTACCCACGTCGTGAGTCTCGTCGGATGGGGTACCGACGTGAAGACGGGTGTCAAGTATTGGATCGTTCGCAACTCGGACGG
TACCAATTGGGGGGACCGGGGCTTCTTCCTCGCTGAAAGAGGGGTGAACATTTACAATATGGAAAGTCATGGAGCGTGGGCTGTTCCTATTGTGTAGCGA
CCATAATCGTA