Description :
From Genome Similarity Track
Location :
Scaffold_69:15150- 16572
Transcript NameFunction/comments
Physo_138996reverse transcriptase

Sequence
1422 bases(100 bases per row)
ACCACAAGCAAGTATGTTCAGTTCGTCATGCTTTTGACCGAGGACTGCACAGGCTGCCCACTGGTTCGCGTGAGGAATGATGACGAACGGCTTGGTCCGG
TCCGGATGACGTAGCAATGGGGTCGACACGATCTTCCGCTTCAGGATCTCGAACGCTTCCTTCGCCCTCGACAAGTCCCTACCGGATCGCACTTGGTCGT
CGCTCAGCTCGTACAGGACTGCAGCTACCACCGGGAAATCCTCTATGAACTTGTGGTAGTAGTTCAGACTGCCGAGGAAGGACTGGACCCCCTTCAGAGT
AGACGGGAATGGTAGATCCAGTACGCCCTTAGCGATCTTCGGCGTCGCCCTGAGTCCTTCTGCACTGATCTCATGAGAGAGATACGGGATCGAGCGCTTA
CCGAATTCACTCTTCGGTAGACTGACAGAGATGTTCCAATACCGCAACCGAAACAGTAGCGCATCCAGATCGATGCGAACTTGATCCCACGTAGGCGCCC
CATGCGCGATGTCGTCAATGAACGAGCTCCGTCCTAGGACAGGGCCCATCTGCATCGGCGCCGGGATGTTACGTTGGAACACAGTCATCTGGTCTGTCAG
CGCGGGTAGACGTCGGCCAGACAGCATTTCGTCGTCCGATCCGGTGTCGCTCCCTCCGACGTTGTCCTCTTGCGGCTTCAAACCCAGATAATCCAGTACG
TCCTGATCCATCTGAGCTTCCTTACCATGTGGTAGTCGAACAAAGCCCCACAGACAGTTGTTGAGCATCTGCTGGTACACCAGCGGAGCATTCTTCAGAC
CAAATGGCATCCGTCGCCACTGGTAGTGACCGAATGGCGACACGAACGCCGAGATGAGCTTGGCTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGC
CATGTCCAGACTCATAAACCACATCGCGCTCTCGAACCCGATTAGCAGGTCGTCAATGAGCGGGAGAGGATAGTTGGACAACTGGATGAACCCGTTCACG
ATCCGGTAACCAATGCACATCCGGATGTCGACCCCGTTCTTCTTCAGTACGATCACGATCGGTGACGCCCAGGGTGACGTAGATGTCTCGATCAATCCAG
TCTCCAACAACTTCTTCAGCAACGTACACCTTCATCGCAAGGTGTGACGCGACCGAGCGTGTCCTTTGTGCGACAGGCTTAGCGTCTCCCACATCCAGAT
CGCAAACGACCCCGCGAGCTGGGGCAGGTGCCGCATTTCCATCACCTAAGAAGATACTTCGGTGGTACCTCAGGATACCACGTAATCGGTGTTCGTCATC
TGGCGTGCTCACGCCAGGTTCGCCAACATCTCGCACTCGGGACTTAAATCCTGCACCTCCGGGAGGAGTGCGAGTTGGTCTCGCAGCTGGGAGAGCAGAT
CGATCCCTTCATGAATGTACAC