Description :
From Genome Similarity Track
Location :
Scaffold_596:1515- 3637
Sequence
2122 bases(100 bases per row)
CGCGCCTATCAGCTCAGAATGCCTCACGATGGATTGACAGTCGGTCGGCAGCTTCAAATATGTGATTGCCAATAGCTTGGCAAACCGTATGCGTGCTTAT
GTAGTGGCGAGCCTTCGCCAGTTCAACATGAGCAACACTTCCCGAAGCCTGTTGAGTAGACGCGTAATCATTCGCTATAGTGCTCTACTCAAGCACGTGC
TAGTCGTGGCCTCATTGGTTGAAGGGGCCAAGCTGCAAGATAGTAATCAGAGATTGGGTGAAGAGAGCACGCAAGCACGTGCTCGCTTGACGCCAAGAAT
CACAAGCTAGATGTAGGCGCAGTAGCCGTCGAACTAGGACTTGGTTTCATTTGCATGCCACTAATCTACTCACTCTTCAAAATTCAAGCAAGTCATCAAG
GCCTATAGGCAAAACTCAAGAAACGGATTAAATGTAAGCTTCAGACGAAAAGCGCTGGCTTGAAGCAGCCAAAGATGCGACACTAGACGAAGGTAGCAAG
TTCGAAGCTACCGTTTCGTTTCTCAGTGAGGTATATTGACATCACTCAGCTATGCTAACGACTTCCTATGCCCGTTCTAGTGTTTGCCCCAACGCCGCCC
ACTAGCCTTTTTTTTCGGCCCGAGCTGTGCTCCACCATCACTTCCGCCATCTTGCTTCGTGGATTCAGTAGTGTCTACTCATTGGGCGATGTCTCCGTCC
AGGTGTTGTAGCACCTTTGCCCATCTTTGTTGTTGCGTTGGGTTGCCGTCAACGCATACTTGTACATTTCTCTGTGTGTCCATTGCCTGGTTCGCAAGTG
TGTCAACTATGTTGTTGTGACCTCTCAGATGATGATGCTACTTGATCACATGTAGCTTGTCCGCTATCCTTATGCACTTCCAGTAGGTGTGCTTGAGGTG
ATTTGCTTTGGGCAGTTTCTGCCGTAATTCGAAGCTACCGTCATCAATCTCACCGCTTGCACCAAACATAGCATGCGTGGagtgtagccctgctacaata
AGTGCTTCAAGCGTTTCGGCTGACAACATTTCCCATGCCGCCAAAaccgccttcttgagctgttcctTGGAGTCATACTGCTTGCCACCGGCGTAGACTT
GCTGTGCCATGATTCCCCAGACGTTTTCAATCGGGTTTAAGTCGGGTGAAAGCACTGGCCATGCGAGAACTTGAATCCCTTAAACAGCAATCCACTGCTT
GGTATAATCCGACGTGTGACATGGAGCGTTGTCTTGCTGAGATATTTGGGGTTCAGTATCGATAAAGGGTTGTAAATGTGTTTCAAGCGTAgccacgtac
ttggtggaatCCTGCCTATATTTTAAAATCTTCAAATCACTTTTCTTCCCGCCGCAAAAAGCACCCCACATCATGACCGATCCACCACCACTATGACGAC
GCACGTTGCCCTCCTCTGCGCGACGGGTATCAACCCAATGGTAGCGCATACCATCGGGTCCGTCGAGGTTCCACTTCTTCTCACCACTGAAGATAATATG
GCATCACTCGATGCCGTCCATGAGCGCCATTTCCTCGGCCCACTTGGTTCGTACTCCTTTGTGTCGACTCGTCAACAGTGGAGCGGCATAACACTTTTTG
TACTTTAGCCAATTCACTTCCTTGTTCACACGTTGGACCGTACGCACGTTACAGCTGAGTTCAAGTCTTGTCTTAATCTGTTTGGCGGACATTTTCCTCA
TAGAAATCAACCGGATAATGTGTCGCTTTTGACGTTTGGTGACCTTTGAACTGCTTCCGAGAGGTTTGTGATGCTATATTTTGGCAGGTGTTCTGATTTT
ACGCTGACAAGCATCCACTGAGCGTTTTAAAGCTTCAACGATCGTCCTGATCGTGATACCCTTCGCGGCAAGTGACTTCATGGTGTTGCGCTCTTTATCA
GTCAAAAACGTGCCACGTGCCATCTCTGACAAACTGAAAACTGGCTTACAAAACCACTAAACAACATTGAGTAATATAAACATACTTACAATGTAAAATG
AATGGCTGAAAACAAGCTTACCAAATCTTTCCGTGCAAAGAATCTTATGTTCATATTATGTGTCACACCTCAAAAATGAATATCCCTACATATTTTCAAA
ACTACAACGAATTTTTCGACAA