Description :
From Genome Similarity Track
Location :
Scaffold_2403:1515- 2879
Sequence
1364 bases(100 bases per row)
CGCGCAGCGAATCTTCGGTGAGGGGTGGCGGACCACCAGCTGGGGCAGGAGGAACAGCAGGAGCCATCTCCGCGGGTTCAGCGACGACGGGGAGTGCTGC
AGGAGCTATCGCAGGGAGTGAAGAGTCCGGGGCAGCAGGCGCCGGAGGACCGGTTGATGACGCTGCTGTCGGGGGAAGTGCAGCAGACTGAAGGGCGCTC
GAACCCTCGGTCTTGCCCTCCTGAGAAATAAGTCGAGTGACACGAGGTGATGAGCAAGGTACCGATGATTCAGGAGAAGGATAGGCTTACGTACCTCCAG
CTGCTCACGTTCGCGACGTCTACGAGGATTGAGACGCTGAAAAGCGTCGGACACGGCTCGACTCAGACGCTTGTACATACGGTGGCGAGATGGTGAATTG
AAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGGCTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCTGTAGTTGCGGATTTCGCCT
CGACAAGACGTGACACCGCCCAGTGTTCAGCGAGACCCTCGCTCGGTAATGTACGGAACGCGATGTCCCAGGGAATGGCCGGGGTCCCCTTCCTATCTTT
CCACGATATTGTGGATTGGGGCCTCTTTCTTCATTAATCCCCAGGGCTTCCTTATATATTAATAAAGGGATGGGCGGTTTTTCCCCTGCATTCAGCGGGC
CCTTTTACGGTACGAACCCTCAAGTGGCTGGTTGGGAATGAGTTCGCAGAAGCCTCAGCGACCCTTGGAAGGCACGTTCACCGTCTGGGACAGGGCGCGG
ACCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTTGGCATGCAAGAAGATCCATAACGGATCCATTGTTCAACTTGATATTTGTATACTTGATTA
GGACTTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCATTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGT
CAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAGCTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGA
TTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTATTTCTTCCAGCCGAGTGTTGA
ACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGATTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTA
GCGTGTTCTTATTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGC