Description :
From Genome Similarity Track
Location :
Scaffold_666:15149- 16732
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_666-snap-gene-0.8Aspartate aminotransferase

Sequence
1583 bases(100 bases per row)
GAGGCTGGCGCATGGGGTTTTGGCTGTTCCCGAGTAGTATGGCATGGCTGCGGAAGTCAATGCTCGTTATGGCATCGGAGACATATACCTCGGTTGCATC
CCCAATTCAGCATGCAGCACGAAGAGCGTTCGTATTAGAGTACGTAGCCGCGCGATTACTGATCCCcGTTGCTTCTGACGTTGAATCACGTGGACAGCTG
CATCGAGCTCTCATCGTACAAGCAAAAGTGCTGCAAGaTCCTCAAGATCATCGGCCAATGGTGCCACTATCAGCTGAAAAAGATGTGTGTGGATGCACAA
CCTCCAGAAGGCGGATTCTATCTATTtCCATCTTTCGCACGTCATCGGAAAGtCcTCATGGACCGCGGAATCACCACCGATGTTGAGTTGTGTCATCGCC
TTCTGCACGATACTGGAGTtGCGATTTTGCCTGGATCCGCCTTCGGACGAAaCCCGCAGGAGCTATACGCACGCCTCGCATTTGTCGACTTCAAGGGCGA
TATTGCCTTGTACCTTATCGAAAGCATGGTATGTCCctGTCCATGCGTGgTGGAAAGAAGCAATCTCACGAATTGATTGTTATCTCAGCAGGACAACTTT
GGATTGgAGGCAATTGACGCCTTCATTCAGTCAGTATGTCCAAATCTCGATATCGCCATGCGACGACTATCATCTTGGATTGCCAATCCTCCGATCCACC
CCGAGCAGGGGGCTACAGCGTCGATCGCTCTTCCAGTTGTGCCGAGTGCCCTATTGGTGACGCCTCAGATATCTGCAGTCACAGCCAAATCGGTTGACGA
GTTATGACGCCAGCAGGGTACGGCGTCGTCCGCGGCGTCCGTGCCCACGACTTCGACCTCCAGCCCGTGTGTCCAACCTCCGACCACATCCAATGCCTCT
GCCGAGGGAGATGATGACGAGGAGTCGATGCTACCCCTTGACGGATTTTGAATGCCAGATCGTTTGTTCCGGACCTTCGGGGTGAACTTTCTCTACGGTC
GCAACTACAGAAACCTTTCATACCCTCTATGATTATTGCGTGTCtGCCCATGCTGtGTAAGTTCCGACATGGAGCCTCTAAGGTCTCATGCAGAAGGCCC
AGAATTCGTTGACTCGAGTGAAGCACTGGCCATGCCGAACTTCAGCCCAGTGCGCGACTGTGTGTGTCTGGCCGGAGTCGGACGAGCCGCATCAGCGGCA
TGTACCCCAGCAGCTTCAACTGACTTGTAGCACATaTCTTGCCGTAtGACGGCCTGCCaTCGCCGTCGCTGCCAATTTTTGCGCTCGCATGTCTCTCCCT
TGCTGCCTTCCCCTGATTCGTCGCGCCCTCGGCGCCCTCGCTTCGTCACATCCGCTGCGCCTCCCGCCATCAGACAAGGCGCTGCCCGCGCACCTCGTCG
TGGAGTCGCGTCCTGACTCGGCAGCGAAGAACGCACCTCAACTCATCCTCGCCCTGACCAGCCTTCTTTTCTCCGAGAATCTTGGTGCTGCACCCATGCG
TGCGGTCGCCCCGCCCAGCCGGTGCTGGCGCACGCAGGACTAAGACCCTCATACTACCTACCAGCCGCGTCCAACACAGtGTG