Description :
From Genome Similarity Track
Location :
Scaffold_7:151467- 153109
Transcript NameFunction/comments
Hyaar_Emoy2801462gag protein

Sequence
1642 bases(100 bases per row)
TGGAATCACCCTCATGCGATGTAAGCGCTTCAGCATAAAGCTGACTTCCCTCAAGGGAACCACTTCGAGCATAATTGCAAGACGCTCCAGAATCGATTAA
AATCGACCAGGGCTTTTCAAAGCCTTTAACTTTCGCCTCAGCGACCAACAAGCCAGACTTGTATCCACGCTCCATACCAGGAGGTATGAAACTCTTGGGG
CTAAGCCCTATTCAACGTTACCTCCTAAAGGTGTTACAGAACCTTGTTCTTCCTTAGTAGGGCGCCGCGCGCCTACTGAGTGTCGGCATTTCCCCGCGCC
ATGCAAGACTTCTGGCTCGGGGTAGAGTGTTGCCTCGTAGCCTGGCGCTGTCTACGCAAAGGGCAACCAGGCCGTAAGCGTTTAGTGCTTCCACACGTAT
AACACCGTCGTACAACACGTTTCTGCTCAGCAACTTGAAGATCAACTTCACCTTCAGCTTCAGCATAGCTGAGATCCATCGGTTCCGGCCTATTAACGGC
CGAAGTACTCGTGTAGTTTGCTCTCGCAGAGCTAGGGTTGTACCCATTCCAGCTAAGTCTGGCCGACTTGAAGTTACGCTCAGCAATAAGAGCAATTCTC
ACAGCCCCTTCGAATGTACAGGGGTGAACCCGAAAGACTTCGGTTCTGGCAACACCAGTACGGAGACCCTCTATGAATATAGTCACATAGACTGCTTCAG
GCAGAGGGTCAGACTGCATAGCAGCCATGAGAGTTCTCAACTCTTGGACATAGTACGTTAACTCATTCTTACCCTGACAGGTTGATAAAAAGCGTGAACG
CACGCGTTAAGCCTGGTTATGTGGTCAAAACACCTGTACCAATTGTGACTTAAGCGACTCCCATGTGGAAAACGCTGAGTCGACCGACGTGCTACACGTC
AAGGCCCGTTCTCTAGCTCATCCATCGAGCTTTGAGATAGCCAGAGAGACCTGTTGATGGCGAAGCTTGATCAGGCCTGATCTCATGGCCATCTCGGTCT
CATGGATCCAGAGGATGAGGTTTTCACCCTCCTTTCCTGAGTAGTTTTTAACTTCCACTCTAAGTGGACGAGGCCTAGCCTCTTCGTCTGGAACAGACAC
ATAGCGTGTAGGCATAGCCGACGCCATTTGGTCTTGGACCTGCCCGAGAAGGGACACTTCATACTGGAAGAAGACCTCAACATGTGCAGTCAGCACTTCC
GGGCCTTGCGATACAAGGTATTCCACTGGACCCAAAGATGCGGTTAGCTTATCAAGCGCGACCTTTTGGGCCTCAGAGAGGGGAGTGGGGTTTTCCATCC
TCACAGAGGATCAGTTTTTAAAGACTCAGGCGTAGATTAACTACGAGTGCTACCAAGTGTAGTGGAGCTACACAGCTCCTTAAGTCAGAGGAAGAATTAG
TGCTCAAAGAGCGATATTAGTTCCAAAGAACTAAACTCTATGAGTCAACAAGCGTAAAACTTAAGGTCCATGTTCCATGGGACCGAAAGATTCGGTGACT
ATACAGCACTTAGTGCTCAAAAGTAGTTATCTCAGAGAGATGTTGCTAACTCTTAACGATTGAAGACACCTCGCAAGGCACGTGTCTTAGGCAAGATCAA
AAGGGGAACTGAACTAAATTTACGTTTTACTCTATAGAATAT